Stem-loop sequence hsa-mir-29b-1

Accession MI0000105
Previous IDs hsa-mir-102-7.1;hsa-mir-102-2;hsa-mir-29b-2
Symbol HGNC:MIR29B1
Description Homo sapiens miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-         -          u      gu      uuaaa 
 cuucaggaa gcugguuuca auggug  uuagau     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucuu ugacuaaagu uaccac  gaucug     g
g         g          u      --      uuagu 
Get sequence
Deep sequencing
63942 reads, 54 experiments
Comments

Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MI0000143 ) and so has been renamed here for consistency.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 130562218-130562298 [-]
antisense
OTTHUMT00000338093 ; AC016831.7-001; intron 2
OTTHUMT00000338093 ; AC016831.7-001; intron 2
OTTHUMT00000338093 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-29b-1
hsa-mir-29b-1 chr7: 130562218-130562298 [-]
hsa-mir-29a chr7: 130561506-130561569 [-]
Database links

Mature sequence hsa-miR-29b-1-5p

Accession MIMAT0004514
Previous IDs hsa-miR-29b-1*
Sequence

10 - 

gcugguuucauauggugguuuaga

 - 33

Get sequence
Deep sequencing 157 reads, 17 experiments
Evidence experimental; cloned [3-4]
Predicted targets

Mature sequence hsa-miR-29b-3p

Accession MIMAT0000100
Previous IDs hsa-miR-29b
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing 127198 reads, 44 experiments
Evidence experimental; cloned [1-4], Northern [2]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).