Stem-loop sequence hsa-mir-100

AccessionMI0000102
Previous IDshsa-mir-100-11
Symbol HGNC:MIR100
DescriptionHomo sapiens miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       -uu c    a   cg     c   a      - uau 
5' ccug   g caca acc  uagau cga cuugug g   u
   ||||   | |||| |||  ||||| ||| |||||| |    
3' ggau   c gugu ugg  aucua guu gaacac c   a
       ugu u    a   au     u   c      g cug 
Get sequence
Deep sequencing
33962 reads, 2.8e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is localised to chromosome 11 and was named mir-100-11 in reference [1].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 122152229-122152308 [-]
sense
OTTHUMT00000387568 ; RP11-820L6.1-006; intron 2
OTTHUMT00000387569 ; RP11-820L6.1-008; intron 2
OTTHUMT00000387570 ; RP11-820L6.1-007; intron 2
OTTHUMT00000387551 ; RP11-820L6.1-001; intron 3
ENST00000529804 ; RP11-820L6.1-006; intron 2
ENST00000529733 ; RP11-820L6.1-008; intron 2
ENST00000528381 ; RP11-820L6.1-007; intron 2
ENST00000527474 ; RP11-820L6.1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-100
hsa-mir-100chr11: 122152229-122152308 [-]
hsa-let-7a-2chr11: 122146522-122146593 [-]
Database links

Mature sequence hsa-miR-100-5p

Accession MIMAT0000098
Previous IDshsa-miR-100
Sequence

13 - 

aacccguagauccgaacuugug

 - 34

Get sequence
Deep sequencing1004 reads, 47 experiments
Evidence experimental; cloned [1-3], Illumina [4]
Validated targets
Predicted targets

Mature sequence hsa-miR-100-3p

Accession MIMAT0004512
Previous IDshsa-miR-100*
Sequence

48 - 

caagcuuguaucuauagguaug

 - 69

Get sequence
Deep sequencing16 reads, 8 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4