Stem-loop sequence hsa-mir-99a

AccessionMI0000101
Previous IDshsa-mir-99-21;hsa-mir-99
Symbol HGNC:MIR99A
DescriptionHomo sapiens miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Deep sequencing
17231 reads, 3.4e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is localised to chromosome 21 and was named mir-99-21 in reference [1].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr21: 16539089-16539169 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-99a
hsa-mir-99achr21: 16539089-16539169 [+]
hsa-let-7cchr21: 16539828-16539911 [+]
Database links

Mature sequence hsa-miR-99a-5p

Accession MIMAT0000097
Previous IDshsa-miR-99a
Sequence

13 - 

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing1090 reads, 43 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-99a-3p

Accession MIMAT0004511
Previous IDshsa-miR-99a*
Sequence

50 - 

caagcucgcuucuaugggucug

 - 71

Get sequence
Deep sequencing289 reads, 33 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).