Stem-loop sequence hsa-mir-99a

Accession MI0000101
Previous IDs hsa-mir-99-21;hsa-mir-99
Symbol HGNC:MIR99A
Description Homo sapiens miR-99a stem-loop
Gene family MIPF0000025; mir-99
Stem-loop 
cc          a         uc   u      g  aag 
  cauuggcaua acccguaga  cga cuugug ug   u
  |||||||||| |||||||||  ||| |||||| ||    
  gugacugugu uggguaucu  gcu gaacac gc   g
gu          c         uc   c      -  cag
Get sequence
Deep sequencing
21431 reads, 42 experiments
Comments

This sequence is localised to chromosome 21 and was named mir-99-21 in reference [1].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr21: 17911409-17911489 [+]
sense
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
ENST00000441820 ; C21orf34-003; intron 1
ENST00000441820 ; LINC00478-003; intron 1
ENST00000441820 ; LINC00478-003; intron 1
ENST00000428669 ; C21orf34-007; intron 3
ENST00000453910 ; C21orf34-009; intron 3
ENST00000418813 ; C21orf34-010; intron 3
ENST00000428669 ; LINC00478-007; intron 3
ENST00000453910 ; LINC00478-009; intron 3
ENST00000418813 ; LINC00478-010; intron 3
ENST00000428669 ; LINC00478-007; intron 3
ENST00000453910 ; LINC00478-009; intron 3
ENST00000418813 ; LINC00478-010; intron 3
ENST00000400178 ; C21orf34-004; intron 5
ENST00000445461 ; C21orf34-006; intron 5
ENST00000400178 ; LINC00478-004; intron 5
ENST00000445461 ; LINC00478-006; intron 5
ENST00000400178 ; LINC00478-004; intron 5
ENST00000445461 ; LINC00478-006; intron 5
ENST00000458468 ; C21orf34-001; intron 6
ENST00000456342 ; C21orf34-002; intron 6
ENST00000458468 ; LINC00478-001; intron 6
ENST00000456342 ; LINC00478-002; intron 6
ENST00000458468 ; LINC00478-001; intron 6
ENST00000456342 ; LINC00478-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-99a
hsa-mir-99a chr21: 17911409-17911489 [+]
hsa-let-7c chr21: 17912148-17912231 [+]
Database links

Mature sequence hsa-miR-99a-5p

Accession MIMAT0000097
Previous IDs hsa-miR-99a
Sequence

13 -  

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing 21370 reads, 41 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-99a-3p

Accession MIMAT0004511
Previous IDs hsa-miR-99a*
Sequence

50 -  

caagcucgcuucuaugggucug

 - 71

Get sequence
Deep sequencing 60 reads, 12 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).