Stem-loop sequence hsa-mir-98

AccessionMI0000100 (change log)
Previous IDshsa-mir-98-X
Symbol HGNC:MIR98
DescriptionHomo sapiens miR-98 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a    uc    -          u                 u    ---------      aggg 
5'  ggau  ugcu caugccaggg gagguaguaaguuguau guug         uggggu    a
    ||||  |||| |||||||||| ||||||||||||||||| ||||         ||||||    u
3'  cuua  acgg gugugguccc uuucaucauucaacaua caau         accccg    a
   a    -u    u          -                 u    agaagauua      gauu 
Get sequence
Deep sequencing
9660323 reads, 6.18e+04 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is localised to chromosome X and was named mir-98-X in reference [1]. The predicted stem-loop precursor sequence is clearly related to let-7.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 53556223-53556341 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-98
hsa-let-7f-2chrX: 53557192-53557274 [-]
hsa-mir-98chrX: 53556223-53556341 [-]
Database links

Mature sequence hsa-miR-98-5p

Accession MIMAT0000096
Previous IDshsa-miR-98
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Deep sequencing9658155 reads, 77 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Database links
Predicted targets

Mature sequence hsa-miR-98-3p

Accession MIMAT0022842
Sequence

80 - 

cuauacaacuuacuacuuuccc

 - 101

Get sequence
Deep sequencing1809 reads, 66 experiments
Evidence experimental; SOLiD [4]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).