Stem-loop sequence hsa-mir-98

AccessionMI0000100 (change log)
Previous IDshsa-mir-98-X
Symbol HGNC:MIR98
DescriptionHomo sapiens miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

137 open access papers mention hsa-mir-98
(563 sentences)

Stem-loop
   a    uc    -          u                 u    ---------      aggg 
5'  ggau  ugcu caugccaggg gagguaguaaguuguau guug         uggggu    a
    ||||  |||| |||||||||| ||||||||||||||||| ||||         ||||||    u
3'  cuua  acgg gugugguccc uuucaucauucaacaua caau         accccg    a
   a    -u    u          -                 u    agaagauua      gauu 
Get sequence
Deep sequencing
22596706 reads, 4.51e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is localised to chromosome X and was named mir-98-X in reference [1]. The predicted stem-loop precursor sequence is clearly related to let-7.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 53556223-53556341 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-98
hsa-let-7f-2chrX: 53557192-53557274 [-]
hsa-mir-98chrX: 53556223-53556341 [-]
Database links

Mature sequence hsa-miR-98-5p

Accession MIMAT0000096
Previous IDshsa-miR-98
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Deep sequencing22592846 reads, 159 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Database links
Predicted targets

Mature sequence hsa-miR-98-3p

Accession MIMAT0022842
Sequence

80 - 

cuauacaacuuacuacuuuccc

 - 101

Get sequence
Deep sequencing3413 reads, 126 experiments
Evidence experimental; SOLiD [4]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).