Stem-loop sequence hsa-mir-96

AccessionMI0000098 (change log)
Previous IDshsa-mir-96-7
Symbol HGNC:MIR96
DescriptionHomo sapiens miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

193 open access papers mention hsa-mir-96
(1213 sentences)

Stem-loop
   ugg  g  u        a      uu      ---   uc 
5'    cc au uuggcacu gcacau  uugcuu   gug  u
      || || |||||||| ||||||  ||||||   |||   
3'    gg ua aaccguga cgugua  aacgag   cgc  c
   aaa  g  u        -      cu      ucu   cu 
Get sequence
Deep sequencing
277421 reads, 484 reads per million, 152 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is localised to chromosome 7 and was named mir-96-7 in reference [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 129774692-129774769 [-]
antisense
OTTHUMT00000349347 ; KLHDC10-001; exon 10
ENST00000335420 ; KLHDC10-001; exon 10
Clustered miRNAs
< 10kb from hsa-mir-96
hsa-mir-183chr7: 129774905-129775014 [-]
hsa-mir-96chr7: 129774692-129774769 [-]
hsa-mir-182chr7: 129770383-129770492 [-]
Database links

Mature sequence hsa-miR-96-5p

Accession MIMAT0000095
Previous IDshsa-miR-96
Sequence

9 - 

uuuggcacuagcacauuuuugcu

 - 31

Get sequence
Deep sequencing277023 reads, 152 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-96-3p

Accession MIMAT0004510
Previous IDshsa-miR-96*
Sequence

52 - 

aaucaugugcagugccaauaug

 - 73

Get sequence
Deep sequencing364 reads, 65 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).