Stem-loop sequence hsa-mir-95

Accession MI0000097
Previous IDs hsa-mir-95-4
Symbol HGNC:MIR95
Description Homo sapiens miR-95 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
a   c      ca          gu         -   aa 
 aca aguggg  cucaauaaau  cuguugaau uga  u
 ||| ||||||  ||||||||||  ||||||||| |||   
 ugu ucaccc  gaguuauuua  ggcaacuua auu  g
g   c      ac          ug         c   gc 
Get sequence
Deep sequencing
1083 reads, 22 experiments
Comments

This sequence is localised to chromosome 4 and was named mir-95-4 in reference [1].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 8007028-8007108 [-]
sense
OTTHUMT00000127607 ; ABLIM2-012; intron 4
OTTHUMT00000127607 ; ABLIM2-012; intron 4
OTTHUMT00000127607 ; ABLIM2-012; intron 4
OTTHUMT00000127606 ; ABLIM2-005; intron 10
OTTHUMT00000127606 ; ABLIM2-005; intron 10
OTTHUMT00000127606 ; ABLIM2-005; intron 10
OTTHUMT00000358860 ; ABLIM2-001; intron 13
OTTHUMT00000358886 ; ABLIM2-006; intron 13
OTTHUMT00000358860 ; ABLIM2-001; intron 13
OTTHUMT00000358886 ; ABLIM2-006; intron 13
OTTHUMT00000358860 ; ABLIM2-001; intron 13
OTTHUMT00000358886 ; ABLIM2-006; intron 13
OTTHUMT00000363009 ; ABLIM2-003; intron 14
OTTHUMT00000363009 ; ABLIM2-003; intron 14
OTTHUMT00000363009 ; ABLIM2-003; intron 14
OTTHUMT00000358862 ; ABLIM2-002; intron 15
OTTHUMT00000358884 ; ABLIM2-004; intron 15
OTTHUMT00000358862 ; ABLIM2-002; intron 15
OTTHUMT00000358884 ; ABLIM2-004; intron 15
OTTHUMT00000358862 ; ABLIM2-002; intron 15
OTTHUMT00000358884 ; ABLIM2-004; intron 15
OTTHUMT00000363013 ; ABLIM2-016; intron 16
OTTHUMT00000363013 ; ABLIM2-016; intron 16
OTTHUMT00000363013 ; ABLIM2-016; intron 16
ENST00000512594 ; ABLIM2-012; intron 4
ENST00000512594 ; ABLIM2-012; intron 4
ENST00000512594 ; ABLIM2-012; intron 4
ENST00000514025 ; ABLIM2-005; intron 10
ENST00000514025 ; ABLIM2-005; intron 10
ENST00000514025 ; ABLIM2-005; intron 10
ENST00000407564 ; ABLIM2-001; intron 13
ENST00000505872 ; ABLIM2-006; intron 13
ENST00000407564 ; ABLIM2-001; intron 13
ENST00000505872 ; ABLIM2-006; intron 13
ENST00000407564 ; ABLIM2-001; intron 13
ENST00000505872 ; ABLIM2-006; intron 13
ENST00000361737 ; ABLIM2-003; intron 14
ENST00000546334 ; ABLIM2-205; intron 14
ENST00000361737 ; ABLIM2-003; intron 14
ENST00000546334 ; ABLIM2-205; intron 14
ENST00000361737 ; ABLIM2-003; intron 14
ENST00000546334 ; ABLIM2-204; intron 14
ENST00000341937 ; ABLIM2-002; intron 15
ENST00000361581 ; ABLIM2-004; intron 15
ENST00000545242 ; ABLIM2-204; intron 15
ENST00000318888 ; ABLIM2-202; intron 15
ENST00000341937 ; ABLIM2-002; intron 15
ENST00000361581 ; ABLIM2-004; intron 15
ENST00000545242 ; ABLIM2-204; intron 15
ENST00000318888 ; ABLIM2-202; intron 15
ENST00000341937 ; ABLIM2-002; intron 15
ENST00000361581 ; ABLIM2-004; intron 15
ENST00000545242 ; ABLIM2-203; intron 15
ENST00000318888 ; ABLIM2-202; intron 15
ENST00000447017 ; ABLIM2-016; intron 16
ENST00000296372 ; ABLIM2-201; intron 16
ENST00000447017 ; ABLIM2-016; intron 16
ENST00000296372 ; ABLIM2-201; intron 16
ENST00000447017 ; ABLIM2-016; intron 16
ENST00000296372 ; ABLIM2-201; intron 16
ENST00000400045 ; ABLIM2-203; intron 18
ENST00000400045 ; ABLIM2-203; intron 18
Database links

Mature sequence hsa-miR-95

Accession MIMAT0000094
Sequence

49 - 

uucaacggguauuuauugagca

 - 70

Get sequence
Deep sequencing 1081 reads, 20 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).