Stem-loop sequence hsa-mir-93

AccessionMI0000095 (change log)
Previous IDshsa-mir-93-7.1;hsa-mir-93-1
Symbol HGNC:MIR93
DescriptionHomo sapiens miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

297 open access papers mention hsa-mir-93
(1877 sentences)

Stem-loop
             -ca       -     u    g   ug  au 
5' cugggggcuc   aagugcu guucg gcag uag  ug  u
   ||||||||||   ||||||| ||||| |||| |||  ||   
3' ggcccccgag   uucacga cgagu cguc auc  ac  a
             ccc       u     -    -   ca  cc 
Get sequence
Deep sequencing
775423 reads, 2e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-93 locus on chromosome 7. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 100093768-100093847 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-93
hsa-mir-106bchr7: 100093993-100094074 [-]
hsa-mir-93chr7: 100093768-100093847 [-]
hsa-mir-25chr7: 100093560-100093643 [-]
Database links

Mature sequence hsa-miR-93-5p

Accession MIMAT0000093
Previous IDshsa-miR-93
Sequence

11 - 

caaagugcuguucgugcagguag

 - 33

Get sequence
Deep sequencing764621 reads, 158 experiments
Evidence experimental; cloned [1,3-6], Northern [4]
Database links
Predicted targets

Mature sequence hsa-miR-93-3p

Accession MIMAT0004509
Previous IDshsa-miR-93*
Sequence

50 - 

acugcugagcuagcacuucccg

 - 71

Get sequence
Deep sequencing10791 reads, 156 experiments
Evidence experimental; cloned [5]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).