miRNA Entry for MI0000095

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

mir-17 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-17
Identifiers
Symbol	mir-17
Rfam	RF00051
miRBase	MI0000071
miRBase family	MIPF0000001
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA.^[1]^[2]

A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.^[3]

[edit] References

^ Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T (2001). "Identification of novel genes coding for small expressed RNAs.". Science 294 (5543): 853–8. doi:10.1126/science.1064921. PMID 11679670.
^ Ambros V (2001). "microRNAs: tiny regulators with great potential.". Cell 107 (7): 823–6. doi:10.1016/S0092-8674(01)00616-X. PMID 11779458.
^ Shen J, Ambrosone CB, Zhao H (2009). "Novel genetic variants in microRNA genes and familial breast cancer". Int J Cancer 124 (5): 1178–82. doi:10.1002/ijc.24008. PMID 19048628.

[edit] Further reading

^ Dews M, Fox JL, Hultine S, Sundaram P, Wang W, Liu YY, Furth E, Enders GH, El-Deiry W, Schelter JM, Cleary MA, Thomas-Tikhonenko A (2010). "The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors.". Cancer Res 70 (20): 8233–46. doi:10.1158/0008-5472.CAN-10-2412. PMID 20940405.
^ Xiang J, Wu J (2010). "Feud or Friend? The Role of the miR-17-92 Cluster in Tumorigenesis.". Curr Genomics 11 (2): 129–35. doi:10.2174/138920210790886853. PMC 2874222. PMID 20885820.
^ Wang Z, Liu M, Zhu H, Zhang W, He S, Hu C, Quan L, Bai J, Xu N (2010). "Suppression of p21 by c-Myc through members of miR-17 family at the post-transcriptional level.". Int J Oncol 37 (5): 1315–21. PMID 20878079.
^ Hong L, Lai M, Chen M, Xie C, Liao R, Kang YJ, Xiao C, Hu WY, Han J, Sun P (2010). "The miR-17-92 cluster of microRNAs confers tumorigenicity by inhibiting oncogene-induced senescence.". Cancer Res 70 (21): 8547–57. doi:10.1158/0008-5472.CAN-10-1938. PMC 2970743. PMID 20851997.
^ Osada H, Takahashi T (2010). "Review Article: let-7 and miR-17-92: Small-sized major players in lung cancer development.". Cancer Sci 102 (1): 9–17. doi:10.1111/j.1349-7006.2010.01707.x. PMID 20735434.
^ Cox MB, Cairns MJ, Gandhi KS, Carroll AP, Moscovis S, Stewart GJ, Broadley S, Scott RJ, Booth DR, Lechner-Scott J, ANZgene Multiple Sclerosis Genetics Consortium (2010). "MicroRNAs miR-17 and miR-20a inhibit T cell activation genes and are under-expressed in MS whole blood.". In Jacobson, Steven. PLoS ONE 5 (8): e12132. doi:10.1371/journal.pone.0012132. PMC 2920328. PMID 20711463.
^ Yu J, Ohuchida K, Mizumoto K, Fujita H, Nakata K, Tanaka M (2010). "MicroRNA miR-17-5p is overexpressed in pancreatic cancer, associated with a poor prognosis and involved in cancer cell proliferation and invasion.". Cancer Biol Ther 10 (8): 748. doi:10.4161/cbt.10.8.13083. PMID 20703102.
^ Zhuo de X, Niu XH, Chen YC, Xin DQ, Guo YL, Mao ZB (2010). "Vitamin D3 up-regulated protein 1(VDUP1) is regulated by FOXO3A and miR-17-5p at the transcriptional and post-transcriptional levels, respectively, in senescent fibroblasts.". J Biol Chem 285 (41): 31491–501. doi:10.1074/jbc.M109.068387. PMC 2951223. PMID 20656682.
^ Kuhnert F, Kuo CJ (2010). "miR-17-92 angiogenesis micromanagement.". Blood 115 (23): 4631–3. doi:10.1182/blood-2010-03-276428. PMID 20538815.
^ Li H, Bian C, Liao L, Li J, Zhao RC (2010). "miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1.". Breast Cancer Res Treat 126 (3): 565–575. doi:10.1007/s10549-010-0954-4. PMID 20505989.
^ Budde H, Schmitt S, Fitzner D, Opitz L, Salinas-Riester G, Simons M (2010). "Control of oligodendroglial cell number by the miR-17-92 cluster". Development 137 (13): 2127–32. doi:10.1242/dev.050633. PMID 20504959.
^ Grillari J, Hackl M, Grillari-Voglauer R (2010). "miR-17-92 cluster: ups and downs in cancer and aging". Biogerontology 11 (4): 501–6. doi:10.1007/s10522-010-9272-9. PMC 2899009. PMID 20437201.
^ Wong P, Iwasaki M, Somervaille TC, Ficara F, Carico C, Arnold C, Chen CZ, Cleary ML (2010). "The miR-17-92 microRNA polycistron regulates MLL leukemia stem cell potential by modulating p21 expression". Cancer Res 70 (9): 3833–42. doi:10.1158/0008-5472.CAN-09-3268. PMC 2862107. PMID 20406979.
^ Ernst A, Campos B, Meier J, Devens F, Liesenberg F, Wolter M, Reifenberger G, Herold-Mende C, Lichter P, Radlwimmer B (2010). "De-repression of CTGF via the miR-17-92 cluster upon differentiation of human glioblastoma spheroid cultures". Oncogene 29 (23): 3411–22. doi:10.1038/onc.2010.83. PMID 20305691.
^ He S, Yang S, Deng G, Liu M, Zhu H, Zhang W, Yan S, Quan L, Bai J, Xu N (2010). "Aurora kinase A induces miR-17-92 cluster through regulation of E2F1 transcription factor". Cell Mol Life Sci 67 (12): 2069–76. doi:10.1007/s00018-010-0340-8. PMID 20300951.
^ Olive V, Jiang I, He L (2010). "mir-17-92, a cluster of miRNAs in the midst of the cancer network". Int J Biochem Cell Biol 42 (8): 1348–54. doi:10.1016/j.biocel.2010.03.004. PMID 20227518.
^ Tran U, Zakin L, Schweickert A, Agrawal R, DÃ¶ger R, Blum M, De Robertis EM, Wessely O (2010). "The RNA-binding protein bicaudal C regulates polycystin 2 in the kidney by antagonizing miR-17 activity". Development 137 (7): 1107–16. doi:10.1242/dev.046045. PMC 2835326. PMID 20215348.
^ Yang F, Yin Y, Wang F, Wang Y, Zhang L, Tang Y, Sun S (2010). "miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway". Hepatology 51 (5): 1614–23. doi:10.1002/hep.23566. PMID 20209605.
^ Sasaki K, Kohanbash G, Hoji A, Ueda R, McDonald HA, Reinhart TA, Martinson J, Lotze MT, Marincola FM, Wang E, Fujita M, Okada H (2010). "miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy". J Transl Med 8 (1): 17. doi:10.1186/1479-5876-8-17. PMC 2836279. PMID 20167088.
^ Lindberg RL, Hoffmann F, Mehling M, Kuhle J, Kappos L (2010). "Altered expression of miR-17-5p in CD4+ lymphocytes of relapsing-remitting multiple sclerosis patients". Eur J Immunol 40 (3): 888–98. doi:10.1002/eji.200940032. PMID 20148420.
^ Mi S, Li Z, Chen P, He C, Cao D, Elkahloun A, Lu J, Pelloso LA, Wunderlich M, Huang H, Luo RT, Sun M, He M, Neilly MB, Zeleznik-Le NJ, Thirman MJ, Mulloy JC, Liu PP, Rowley JD, Chen J (2010). "Aberrant overexpression and function of the miR-17-92 cluster in MLL-rearranged acute leukemia". Proc Natl Acad Sci U S A 107 (8): 3710–5. doi:10.1073/pnas.0914900107. PMC 2840429. PMID 20133587.
^ Hackl M, Brunner S, Fortschegger K, Schreiner C, Micutkova L, MÃ¼ck C, Laschober GT, Lepperdinger G, Sampson N, Berger P, Herndler-Brandstetter D, Wieser M, KÃ¼hnel H, Strasser A, Rinnerthaler M, Breitenbach M, Mildner M, Eckhart L, Tschachler E, Trost A, Bauer JW, Papak C, Trajanoski Z, Scheideler M, Grillari-Voglauer R, Grubeck-Loebenstein B, Jansen-DÃ¼rr P, Grillari J (2010). "miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging". Aging Cell 9 (2): 291–6. doi:10.1111/j.1474-9726.2010.00549.x. PMC 2848978. PMID 20089119.
^ van Haaften G, Agami R (2010). "Tumorigenicity of the miR-17-92 cluster distilled". Genes Dev 24 (1): 1–4. doi:10.1101/gad.1887110. PMC 2802185. PMID 20047995.
^ Chow TF, Mankaruos M, Scorilas A, Youssef Y, Girgis A, Mossad S, Metias S, Rofael Y, Honey RJ, Stewart R, Pace KT, Yousef GM (2010). "The miR-17-92 cluster is over expressed in and has an oncogenic effect on renal cell carcinoma". J Urol 183 (2): 743–51. doi:10.1016/j.juro.2009.09.086. PMID 20022054.
^ Olive V, Bennett MJ, Walker JC, Ma C, Jiang I, Cordon-Cardo C, Li QJ, Lowe SW, Hannon GJ, He L (2009). "miR-19 is a key oncogenic component of mir-17-92". Genes Dev 23 (24): 2839–49. doi:10.1101/gad.1861409. PMC 2800084. PMID 20008935.
^ Mu P, Han YC, Betel D, Yao E, Squatrito M, Ogrodowski P, de Stanchina E, D'Andrea A, Sander C, Ventura A (2009). "Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas". Genes Dev 23 (24): 2806–11. doi:10.1101/gad.1872909. PMC 2800095. PMID 20008931.
^ Guo L, Sun B, Sang F, Wang W, Lu Z (2009). "Haplotype distribution and evolutionary pattern of miR-17 and miR-124 families based on population analysis". In Poon, Art F. Y. PLoS ONE 4 (11): e7944. doi:10.1371/journal.pone.0007944. PMC 2775919. PMID 19956752.
^ ZHANG ZW, AN Y, TENG CB (2009). "[The roles of miR-17-92 cluster in mammal development and tumorigenesis]". Yi Chuan 31 (11): 1094–100. PMID 19933089.
^ Sun H, Li QW, Lv XY, Ai JZ, Yang QT, Duan JJ, Bian GH, Xiao Y, Wang YD, Zhang Z, Liu YH, Tan RZ, Yang Y, Wei YQ, Zhou Q (2010). "MicroRNA-17 post-transcriptionally regulates polycystic kidney disease-2 gene and promotes cell proliferation". Mol Biol Rep 37 (6): 2951–8. doi:10.1007/s11033-009-9861-3. PMID 19821056.
^ Yan HL, Xue G, Mei Q, Wang YZ, Ding FX, Liu MF, Lu MH, Tang Y, Yu HY, Sun SH (2009). "Repression of the miR-17-92 cluster by p53 has an important function in hypoxia-induced apoptosis". EMBO J 28 (18): 2719–32. doi:10.1038/emboj.2009.214. PMC 2750010. PMID 19696742.
^ Diosdado B, van de Wiel MA, Terhaar Sive Droste JS, Mongera S, Postma C, Meijerink WJ, Carvalho B, Meijer GA (2009). "MiR-17-92 cluster is associated with 13q gain and c-myc expression during colorectal adenoma to adenocarcinoma progression". Br J Cancer 101 (4): 707–14. doi:10.1038/sj.bjc.6605037. PMC 2736819. PMID 19672269.
^ Beveridge NJ, Tooney PA, Carroll AP, Tran N, Cairns MJ (2009). "Down-regulation of miR-17 family expression in response to retinoic acid induced neuronal differentiation". Cell Signal 21 (12): 1837–45. doi:10.1016/j.cellsig.2009.07.019. PMID 19666108.
^ Shan SW, Lee DY, Deng Z, Shatseva T, Jeyapalan Z, Du WW, Zhang Y, Xuan JW, Yee SP, Siragam V, Yang BB (2009). "MicroRNA MiR-17 retards tissue growth and represses fibronectin expression". Nat Cell Biol 11 (8): 1031–8. doi:10.1038/ncb1917. PMID 19633662.
^ Ebi H, Sato T, Sugito N, Hosono Y, Yatabe Y, Matsuyama Y, Yamaguchi T, Osada H, Suzuki M, Takahashi T (2009). "Counterbalance between RB inactivation and miR-17-92 overexpression in reactive oxygen species and DNA damage induction in lung cancers". Oncogene 28 (38): 3371–9. doi:10.1038/onc.2009.201. PMID 19597473.
^ Carraro G, El-Hashash A, Guidolin D, Tiozzo C, Turcatel G, Young BM, De Langhe SP, Bellusci S, Shi W, Parnigotto PP, Warburton D (2009). "miR-17 family of microRNAs controls FGF10-mediated embryonic lung epithelial branching morphogenesis through MAPK14 and STAT3 regulation of E-Cadherin distribution". Dev Biol 333 (2): 238–50. doi:10.1016/j.ydbio.2009.06.020. PMC 2735610. PMID 19559694.
^ Northcott PA, Fernandez-L A, Hagan JP, Ellison DW, Grajkowska W, Gillespie Y, Grundy R, Van Meter T, Rutka JT, Croce CM, Kenney AM, Taylor MD (2009). "The miR-17/92 polycistron is up-regulated in sonic hedgehog-driven medulloblastomas and induced by N-myc in sonic hedgehog-treated cerebellar neural precursors". Cancer Res 69 (8): 3249–55. doi:10.1158/0008-5472.CAN-08-4710. PMC 2836891. PMID 19351822.
^ Robertus JL, Harms G, Blokzijl T, Booman M, de Jong D, van Imhoff G, Rosati S, Schuuring E, Kluin P, van den Berg A (2009). "Specific expression of miR-17-5p and miR-127 in testicular and central nervous system diffuse large B-cell lymphoma". Mod Pathol 22 (4): 547–55. doi:10.1038/modpathol.2009.10. PMID 19287466.
^ Uziel T, Karginov FV, Xie S, Parker JS, Wang YD, Gajjar A, He L, Ellison D, Gilbertson RJ, Hannon G, Roussel MF (2009). "The miR-17~92 cluster collaborates with the Sonic Hedgehog pathway in medulloblastoma". Proc Natl Acad Sci U S A 106 (8): 2812–7. doi:10.1073/pnas.0809579106. PMC 2636735. PMID 19196975.
^ Mraz M, Malinova K, Kotaskova J, Pavlova S, Tichy B, Malcikova J, Stano Kozubik K, Smardova J, Brychtova Y, Doubek M, Trbusek M, Mayer J, Pospisilova S (2009). "miR-34a, miR-29c and miR-17-5p are downregulated in CLL patients with TP53 abnormalities". Leukemia 23 (6): 1159–63. doi:10.1038/leu.2008.377. PMID 19158830.
^ Nagel S, Venturini L, Przybylski GK, Grabarczyk P, Schmidt CA, Meyer C, Drexler HG, Macleod RA, Scherr M (2009). "Activation of miR-17-92 by NK-like homeodomain proteins suppresses apoptosis via reduction of E2F1 in T-cell acute lymphoblastic leukemia". Leuk Lymphoma 50 (1): 101–8. doi:10.1080/10428190802626632. PMID 19148830.
^ Foshay KM, Gallicano GI (2009). "miR-17 family miRNAs are expressed during early mammalian development and regulate stem cell differentiation". Dev Biol 326 (2): 431–43. doi:10.1016/j.ydbio.2008.11.016. PMID 19073166.
^ Aguda BD, Kim Y, Piper-Hunter MG, Friedman A, Marsh CB (2008). "MicroRNA regulation of a cancer network: consequences of the feedback loops involving miR-17-92, E2F, and Myc". Proc Natl Acad Sci U S A 105 (50): 19678–83. doi:10.1073/pnas.0811166106. PMC 2598727. PMID 19066217.
^ Petrocca F, Vecchione A, Croce CM (2008). "Emerging role of miR-106b-25/miR-17-92 clusters in the control of transforming growth factor beta signaling". Cancer Res 68 (20): 8191–4. doi:10.1158/0008-5472.CAN-08-1768. PMID 18922889.
^ Pickering MT, Stadler BM, Kowalik TF (2009). "miR-17 and miR-20a temper an E2F1-induced G1 checkpoint to regulate cell cycle progression". Oncogene 28 (1): 140–5. doi:10.1038/onc.2008.372. PMC 2768269. PMID 18836483.
^ Cloonan N, Brown MK, Steptoe AL, Wani S, Chan WL, Forrest AR, Kolle G, Gabrielli B, Grimmond SM (2008). "The miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition". Genome Biol 9 (8): R127. doi:10.1186/gb-2008-9-8-r127. PMC 2575517. PMID 18700987.
^ Connolly E, Melegari M, Landgraf P, Tchaikovskaya T, Tennant BC, Slagle BL, Rogler LE, Zavolan M, Tuschl T, Rogler CE (2008). "Elevated expression of the miR-17-92 polycistron and miR-21 in hepadnavirus-associated hepatocellular carcinoma contributes to the malignant phenotype". Am J Pathol 173 (3): 856–64. doi:10.2353/ajpath.2008.080096. PMC 2527078. PMID 18688024.
^ Xu X, Hong Y, Kong C, Xu L, Tan J, Liang Q, Huang B, Lu J (2008). "Protein tyrosine phosphatase receptor-type O (PTPRO) is co-regulated by E2F1 and miR-17-92". FEBS Lett 582 (19): 2850–6. doi:10.1016/j.febslet.2008.07.017. PMID 18644370.
^ Taguchi A, Yanagisawa K, Tanaka M, Cao K, Matsuyama Y, Goto H, Takahashi T (2008). "Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster". Cancer Res 68 (14): 5540–5. doi:10.1158/0008-5472.CAN-07-6460. PMID 18632605.
^ Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita S (2008). "Oncogenic role of miR-17-92 cluster in anaplastic thyroid cancer cells". Cancer Sci 99 (6): 1147–54. doi:10.1111/j.1349-7006.2008.00800.x. PMID 18429962.
^ Mendell JT (2008). "miRiad roles for the miR-17-92 cluster in development and disease". Cell 133 (2): 217–22. doi:10.1016/j.cell.2008.04.001. PMC 2732113. PMID 18423194.
^ Ventura A, Young AG, Winslow MM, Lintault L, Meissner A, Erkeland SJ, Newman J, Bronson RT, Crowley D, Stone JR, Jaenisch R, Sharp PA, Jacks T (2008). "Targeted deletion reveals essential and overlapping functions of the miR-17 through 92 family of miRNA clusters". Cell 132 (5): 875–86. doi:10.1016/j.cell.2008.02.019. PMC 2323338. PMID 18329372.
^ Xiao C, Srinivasan L, Calado DP, Patterson HC, Zhang B, Wang J, Henderson JM, Kutok JL, Rajewsky K (2008). "Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes". Nat Immunol 9 (4): 405–14. doi:10.1038/ni1575. PMC 2533767. PMID 18327259.
^ Wang Q, Li YC, Wang J, Kong J, Qi Y, Quigg RJ, Li X (2008). "miR-17-92 cluster accelerates adipocyte differentiation by negatively regulating tumor-suppressor Rb2/p130". Proc Natl Acad Sci U S A 105 (8): 2889–94. doi:10.1073/pnas.0800178105. PMC 2268555. PMID 18287052.
^ Xu W, Li JY, Shen QD, Li L, Yu H (2007). "[DNA sequencing of miR-17-92 cluster at chromosome 13q31-q32 in mantel cell lymphoma cell lines]". Zhongguo Shi Yan Xue Ye Xue Za Zhi 15 (5): 986–8. PMID 17956675.
^ Boggs RM, Moody JA, Long CR, Tsai KL, Murphy KE (2007). "Identification, amplification and characterization of miR-17-92 from canine tissue". Gene 404 (1–2): 25–30. doi:10.1016/j.gene.2007.08.015. PMID 17904311.
^ Lu Y, Thomson JM, Wong HY, Hammond SM, Hogan BL (2007). "Transgenic over-expression of the microRNA miR-17-92 cluster promotes proliferation and inhibits differentiation of lung epithelial progenitor cells". Dev Biol 310 (2): 442–53. doi:10.1016/j.ydbio.2007.08.007. PMC 2052923. PMID 17765889.
^ Tagawa H, Karube K, Tsuzuki S, Ohshima K, Seto M (2007). "Synergistic action of the microRNA-17 polycistron and Myc in aggressive cancer development". Cancer Sci 98 (9): 1482–90. doi:10.1111/j.1349-7006.2007.00531.x. PMID 17608773.
^ Matsubara H, Takeuchi T, Nishikawa E, Yanagisawa K, Hayashita Y, Ebi H, Yamada H, Suzuki M, Nagino M, Nimura Y, Osada H, Takahashi T (2007). "Apoptosis induction by antisense oligonucleotides against miR-17-5p and miR-20a in lung cancers overexpressing miR-17-92". Oncogene 26 (41): 6099–105. doi:10.1038/sj.onc.1210425. PMID 17384677.
^ Rinaldi A, Poretti G, Kwee I, Zucca E, Catapano CV, Tibiletti MG, Bertoni F (2007). "Concomitant MYC and microRNA cluster miR-17-92 (C13orf25) amplification in human mantle cell lymphoma". Leuk Lymphoma 48 (2): 410–2. doi:10.1080/10428190601059738. PMID 17325905.
^ Venturini L, Battmer K, Castoldi M, Schultheis B, Hochhaus A, Muckenthaler MU, Ganser A, Eder M, Scherr M (2007). "Expression of the miR-17-92 polycistron in chronic myeloid leukemia (CML) CD34+ cells". Blood 109 (10): 4399–405. doi:10.1182/blood-2006-09-045104. PMID 17284533.
^ Novotny GW, Sonne SB, Nielsen JE, Jonstrup SP, Hansen MA, Skakkebaek NE, Rajpert-De Meyts E, Kjems J, Leffers H (2007). "Translational repression of E2F1 mRNA in carcinoma in situ and normal testis correlates with expression of the miR-17-92 cluster". Cell Death Differ 14 (4): 879–82. doi:10.1038/sj.cdd.4402090. PMID 17218954.
^ Hossain A, Kuo MT, Saunders GF (2006). "Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA". Mol Cell Biol 26 (21): 8191–201. doi:10.1128/MCB.00242-06. PMC 1636750. PMID 16940181.
^ Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T (2005). "A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation". Cancer Res 65 (21): 9628–32. doi:10.1158/0008-5472.CAN-05-2352. PMID 16266980.
^ Sawera M, Gorodkin J, Cirera S, Fredholm M (2005). "Mapping and expression studies of the mir17-92 cluster on pig chromosome 11". Mamm Genome 16 (8): 594–8. doi:10.1007/s00335-005-0013-3. PMID 16180141.

[edit] External links

Page for mir-17 microRNA precursor family at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence hsa-miR-93-5p
Accession	MIMAT0000093
Previous IDs	hsa-miR-93
Sequence	11 - caaagugcuguucgugcagguag - 33 Get sequence
Deep sequencing	40206 reads, 41 experiments
Evidence	experimental; cloned [1,3-6], Northern [4]
Validated targets	TARBASE:hsa-miR-93-5p
Predicted targets	DIANA-MICROT:hsa-miR-93-5p MICRORNA.ORG:hsa-miR-93-5p MIRDB:hsa-miR-93-5p RNA22-HSA:hsa-miR-93-5p TARGETMINER:hsa-miR-93-5p TARGETSCAN-VERT:hsa-miR-93 PICTAR-VERT:hsa-miR-93

Mature sequence hsa-miR-93-3p
Accession	MIMAT0004509
Previous IDs	hsa-miR-93*
Sequence	50 - acugcugagcuagcacuucccg - 71 Get sequence
Deep sequencing	241 reads, 26 experiments
Evidence	experimental; cloned [5]
Predicted targets	DIANA-MICROT:hsa-miR-93-3p MICRORNA.ORG:hsa-miR-93-3p MIRDB:hsa-miR-93-3p RNA22-HSA:hsa-miR-93-3p TARGETMINER:hsa-miR-93-3p PICTAR-VERT:hsa-miR-93

References
1	PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2	PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3	PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4	PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6	PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).

miRBase

Stem-loop sequence hsa-mir-93

[edit] References

[edit] Further reading

[edit] External links

Mature sequence hsa-miR-93-5p

Mature sequence hsa-miR-93-3p

References