Stem-loop sequence hsa-mir-92a-1

Accession MI0000093
Previous IDs hsa-mir-92-13;hsa-mir-92-1
Symbol HGNC:MIR92A1
Description Homo sapiens miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-92_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-92 microRNAs are short single stranded non-protein coding RNA fragments initially discovered incorporated into an RNP complex with a proposed role of processing RNA molecules and further RNP assembly. Mir-92 has been mapped to the human genome as part of a larger cluster at chromosome 13q31.3, where it is 22 nucleotides in length but exists in the genome as part of a longer precursor sequence. There is an exact replica of the mir-92 precursor on the X chromosome. MicroRNAs are endogenous triggers of the RNAi pathway which involves several ribonucleic proteins (RNPs) dedicated to repressing mRNA molecules via translation inhibition and/or induction of mRNA cleavage. miRNAs are themselves matured from their long RNA precursors by ribonucleic proteins as part of a 2 step biogenesis mechanism involving RNA polymerase 2. Most miRNAs are grouped into clusters in the human genome or within families that share functions, expression profiles, promotors, or are incorporated into the same ribonucleic protein. The purpose of having a variety of miRNAs in a single peace of RNA processing machinery is to act as complementary strands to the recognition elements of a variety of target RNA molecules. The recognition elements of target mRNAs are typically within the 3' untranslated regions and with 678 human miRNAs and 472 mouse miRNAs confidently identified so far (miRBASE) there are extensive efforts taking place using bioinformatics tools to scan genomes for potential recognition elements for families of miRNAs in order to identify potential target genes. Mir-92 is no exception and currently identified gene targets have been among those involved in cell cycle regulation and cell signalling, and thus necessary during all stages of mammalian development and essential for the proliferation of cells. miRNAs can be oncogenes or tumor suppressor genes depending on their targets while mir-92 has been implicated as the former in leukaemia forms AML and ALL, Hepatocellular carcinoma (HCC) and several other cancers. The search for non invasive tools for diagnosis and management of cancer is extremely important for reducing the world wide health burden of cancer. miRNAs show potential as biomarkers and can even be found circulating in the serum. Some circulating miRNAs are specific to tumour patients, while miR-92 on the other-hand is present in healthy individuals in the serum but levels are variable and appear to change in response to the onset of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---cu   uac            c   u           uu 
     uuc   acagguugggau ggu gcaaugcugug  u
     |||   |||||||||||| ||| |||||||||||   
     gag   uguccggcccug uca cguuaugguau  c
gguuu   --u            u   -           gu 
Get sequence
Deep sequencing
225798 reads, 45 experiments
Comments

Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MI0000093 ) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MI0000094 ) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MI0000719 and MI0000580 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 92003568-92003645 [+]
sense
OTTHUMT00000442497 ; MIR17HG-002; exon 2
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000442498 ; MIR17HG-003; exon 3
ENST00000385233 ; MIR92A1-201; exon 1
ENST00000582141 ; MIR17HG-002; exon 2
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000581816 ; MIR17HG-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-92a-1
hsa-mir-17 chr13: 92002859-92002942 [+]
hsa-mir-18a chr13: 92003005-92003075 [+]
hsa-mir-19a chr13: 92003145-92003226 [+]
hsa-mir-20a chr13: 92003319-92003389 [+]
hsa-mir-19b-1 chr13: 92003446-92003532 [+]
hsa-mir-92a-1 chr13: 92003568-92003645 [+]
Database links

Mature sequence hsa-miR-92a-1-5p

Accession MIMAT0004507
Previous IDs hsa-miR-92a-1*
Sequence

11 - 

agguugggaucgguugcaaugcu

 - 33

Get sequence
Deep sequencing 2992 reads, 27 experiments
Evidence experimental; cloned [7-8]
Predicted targets

Mature sequence hsa-miR-92a-3p

Accession MIMAT0000092
Previous IDs hsa-miR-92;hsa-miR-92a
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing 444808 reads, 49 experiments
Evidence experimental; cloned [1,3,5-8], Northern [4]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).