Stem-loop sequence hsa-mir-92a-1

AccessionMI0000093 (change log)
Previous IDshsa-mir-92-13;hsa-mir-92-1
Symbol HGNC:MIR92A1
DescriptionHomo sapiens miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

361 open access papers mention hsa-mir-92a-1
(1539 sentences)

Stem-loop
   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 
Get sequence
Deep sequencing
2873011 reads, 8.6e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MI0000719 and MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91351314-91351391 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-92a-1
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-92a-1-5p

Accession MIMAT0004507
Previous IDshsa-miR-92a-1*
Sequence

11 - 

agguugggaucgguugcaaugcu

 - 33

Get sequence
Deep sequencing32538 reads, 135 experiments
Evidence experimental; cloned [7-8]
Database links
Predicted targets

Mature sequence hsa-miR-92a-3p

Accession MIMAT0000092
Previous IDshsa-miR-92;hsa-miR-92a
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing5313749 reads, 159 experiments
Evidence experimental; cloned [1,3,5-8], Northern [4]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).