Stem-loop sequence hsa-mir-33a

Accession

MI0000091

Previous IDs

hsa-mir-33

Symbol

HGNC:MIR33A

Description

Homo sapiens miR-33a stem-loop

Gene family

MIPF0000070; mir-33

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Stem-loop

              a uu          uucu  u 
cuguggugcauugu g  gcauugcaug    gg g
|||||||||||||| |  ||||||||||    || g
gacacuacgugaca c  uguaacguac    cc u
              c uu          ----  a 

Deep sequencing

3202 reads, 30 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr22: 42296948-42297016 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000321959 ; SREBF2-004; intron 1

  OTTHUMT00000321959 ; SREBF2-004; intron 1

  OTTHUMT00000321959 ; SREBF2-004; intron 1

  OTTHUMT00000321960 ; SREBF2-005; intron 2

  OTTHUMT00000321960 ; SREBF2-005; intron 2

  OTTHUMT00000321960 ; SREBF2-005; intron 2

  OTTHUMT00000321958 ; SREBF2-003; intron 10

  OTTHUMT00000321958 ; SREBF2-003; intron 10

  OTTHUMT00000321958 ; SREBF2-003; intron 10

  OTTHUMT00000321956 ; SREBF2-001; intron 16

  OTTHUMT00000321956 ; SREBF2-001; intron 16

  OTTHUMT00000321956 ; SREBF2-001; intron 16

  OTTHUMT00000321957 ; SREBF2-002; intron 19

  OTTHUMT00000321957 ; SREBF2-002; intron 19

  OTTHUMT00000321957 ; SREBF2-002; intron 19

  ENST00000490262 ; SREBF2-004; intron 1

  ENST00000490262 ; SREBF2-004; intron 1

  ENST00000490262 ; SREBF2-004; intron 1

  ENST00000435061 ; SREBF2-005; intron 2

  ENST00000435061 ; SREBF2-005; intron 2

  ENST00000435061 ; SREBF2-005; intron 2

  ENST00000543221 ; SREBF2-203; intron 9

  ENST00000543221 ; SREBF2-203; intron 9

  ENST00000491541 ; SREBF2-003; intron 10

  ENST00000491541 ; SREBF2-003; intron 10

  ENST00000491541 ; SREBF2-003; intron 10

  ENST00000361204 ; SREBF2-001; intron 16

  ENST00000457567 ; SREBF2-202; intron 16

  ENST00000361204 ; SREBF2-001; intron 16

  ENST00000457567 ; SREBF2-202; intron 16

  ENST00000361204 ; SREBF2-001; intron 16

  ENST00000444813 ; SREBF2-201; intron 18

  ENST00000444813 ; SREBF2-201; intron 18

  ENST00000424354 ; SREBF2-002; intron 19

  ENST00000424354 ; SREBF2-002; intron 19

  ENST00000424354 ; SREBF2-002; intron 19

Database links

• EMBL:AJ421755
• ENTREZGENE: 407039;MIR33A
• HGNC: 31634;MIR33A

Mature sequence hsa-miR-33a-5p

• Accession: MIMAT0000091
• Previous IDs: hsa-miR-33;hsa-miR-33a
• Sequence: 6 - gugcauuguaguugcauugca - 26
• Deep sequencing: 3003 reads, 27 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Validated targets:
  • TARBASE:hsa-miR-33a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-33a-5p
  • MICRORNA.ORG:hsa-miR-33a-5p
  • MIRDB:hsa-miR-33a-5p
  • RNA22-HSA:hsa-miR-33a-5p
  • TARGETMINER:hsa-miR-33a-5p
  • TARGETSCAN-VERT:hsa-miR-33a
  • PICTAR-VERT:hsa-miR-33

Mature sequence hsa-miR-33a-3p

• Accession: MIMAT0004506
• Previous IDs: hsa-miR-33a*
• Sequence: 46 - caauguuuccacagugcaucac - 67
• Deep sequencing: 175 reads, 14 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-33a-3p
  • MICRORNA.ORG:hsa-miR-33a-3p
  • MIRDB:hsa-miR-33a-3p
  • RNA22-HSA:hsa-miR-33a-3p
  • TARGETMINER:hsa-miR-33a-3p
  • PICTAR-VERT:hsa-miR-33

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).