Stem-loop sequence hsa-mir-33a

Accession MI0000091
Previous IDs hsa-mir-33
Symbol HGNC:MIR33A
Description Homo sapiens miR-33a stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                 a uu          uucu  u 
5' cuguggugcauugu g  gcauugcaug    gg g
   |||||||||||||| |  ||||||||||    || g
3' gacacuacgugaca c  uguaacguac    cc u
                 c uu          ----  a 
Get sequence
Deep sequencing
5339 reads, 1.12e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr22: 41900944-41901012 [+]
sense
OTTHUMT00000259153 ; ACO2-003; intron 1
OTTHUMT00000259151 ; ACO2-001; intron 2
OTTHUMT00000259152 ; ACO2-002; intron 2
ENST00000471094 ; ACO2-003; intron 1
ENST00000216254 ; ACO2-001; intron 2
ENST00000396512 ; ACO2-002; intron 2
Database links

Mature sequence hsa-miR-33a-5p

Accession MIMAT0000091
Previous IDs hsa-miR-33;hsa-miR-33a
Sequence

6 - 

gugcauuguaguugcauugca

 - 26

Get sequence
Deep sequencing 3274 reads, 54 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-33a-3p

Accession MIMAT0004506
Previous IDs hsa-miR-33a*
Sequence

46 - 

caauguuuccacagugcaucac

 - 67

Get sequence
Deep sequencing 179 reads, 38 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).