Stem-loop sequence hsa-mir-32

AccessionMI0000090 (change log)
Symbol HGNC:MIR32
DescriptionHomo sapiens miR-32 stem-loop
Gene family MIPF0000069; mir-32
Literature search

103 open access papers mention hsa-mir-32
(574 sentences)

Stem-loop
           ug     u            - uu  c 
5' ggagauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cuuuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Deep sequencing
101876 reads, 222 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 109046229-109046298 [-]
antisense
OTTHUMT00000053526 ; RP11-308N19.1-002; intron 2
ENST00000435485 ; RP11-308N19.1-002; intron 2
Database links

Mature sequence hsa-miR-32-5p

Accession MIMAT0000090
Previous IDshsa-miR-32
Sequence

6 - 

uauugcacauuacuaaguugca

 - 27

Get sequence
Deep sequencing97824 reads, 157 experiments
Evidence experimental; cloned [1-2], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-32-3p

Accession MIMAT0004505
Previous IDshsa-miR-32*
Sequence

47 - 

caauuuagugugugugauauuu

 - 68

Get sequence
Deep sequencing3918 reads, 150 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).