Stem-loop sequence hsa-mir-32

Accession

MI0000090

Symbol

HGNC:MIR32

Description

Homo sapiens miR-32 stem-loop

Gene family

MIPF0000069; mir-32

Stem-loop

        ug     u            - uu  c 
ggagauau  cacau acuaaguugcau g  gu a
||||||||  ||||| |||||||||||| |  ||  
cuuuuaua  gugug ugauuuaacgua c  cg c
        gu     -            a uc  g 

Deep sequencing

1376 reads, 30 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr9: 111808509-111808578 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000356304 ; C9orf5-006; intron 8

  OTTHUMT00000356304 ; C9orf5-006; intron 8

  OTTHUMT00000356304 ; C9orf5-006; intron 8

  OTTHUMT00000053588 ; C9orf5-002; intron 12

  OTTHUMT00000053588 ; C9orf5-002; intron 12

  OTTHUMT00000053588 ; C9orf5-002; intron 12

  OTTHUMT00000053587 ; C9orf5-001; intron 14

  OTTHUMT00000053587 ; C9orf5-001; intron 14

  OTTHUMT00000053587 ; C9orf5-001; intron 14

  ENST00000413712 ; C9orf5-006; intron 8

  ENST00000413712 ; TMEM245-006; intron 8

  ENST00000413712 ; TMEM245-006; intron 8

  ENST00000491854 ; C9orf5-002; intron 12

  ENST00000491854 ; TMEM245-002; intron 12

  ENST00000491854 ; TMEM245-002; intron 12

  ENST00000374587 ; C9orf5-202; intron 13

  ENST00000374587 ; TMEM245-202; intron 13

  ENST00000374586 ; C9orf5-001; intron 14

  ENST00000223608 ; C9orf5-201; intron 14

  ENST00000374586 ; TMEM245-001; intron 14

  ENST00000223608 ; TMEM245-201; intron 14

  ENST00000374586 ; TMEM245-001; intron 14

Database links

• EMBL:AJ421754
• ENTREZGENE: 407036;MIR32
• HGNC: 31631;MIR32

Mature sequence hsa-miR-32-5p

• Accession: MIMAT0000090
• Previous IDs: hsa-miR-32
• Sequence: 6 - uauugcacauuacuaaguugca - 27
• Deep sequencing: 1303 reads, 30 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Validated targets:
  • TARBASE:hsa-miR-32-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-32-5p
  • MICRORNA.ORG:hsa-miR-32-5p
  • MIRDB:hsa-miR-32-5p
  • RNA22-HSA:hsa-miR-32-5p
  • TARGETMINER:hsa-miR-32-5p
  • TARGETSCAN-VERT:hsa-miR-32
  • PICTAR-VERT:hsa-miR-32

Mature sequence hsa-miR-32-3p

• Accession: MIMAT0004505
• Previous IDs: hsa-miR-32*
• Sequence: 47 - caauuuagugugugugauauuu - 68
• Deep sequencing: 71 reads, 18 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-32-3p
  • MICRORNA.ORG:hsa-miR-32-3p
  • MIRDB:hsa-miR-32-3p
  • RNA22-HSA:hsa-miR-32-3p
  • TARGETMINER:hsa-miR-32-3p
  • PICTAR-VERT:hsa-miR-32

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).