Stem-loop sequence hsa-mir-31

AccessionMI0000089 (change log)
Symbol HGNC:MIR31
DescriptionHomo sapiens miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

385 open access papers mention hsa-mir-31
(2755 sentences)

Stem-loop
         ga     g   c         -u   gaa 
5' ggagag  ggcaa aug uggcauagc  guu   c
   ||||||  ||||| ||| |||||||||  |||    
3' ccuuuc  ccguu uac accguaucg  caa   u
         ua     a   a         uc   ggg 
Get sequence
Deep sequencing
120762 reads, 1.26e+03 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 21512115-21512185 [-]
sense
OTTHUMT00000051910 ; RP11-354P17.9-001; intron 1
ENST00000304425 ; MIR31HG-001; intron 1
ENST00000362307 ; MIR31-201; exon 1
Database links

Mature sequence hsa-miR-31-5p

Accession MIMAT0000089
Previous IDshsa-miR-31
Sequence

8 - 

aggcaagaugcuggcauagcu

 - 28

Get sequence
Deep sequencing114253 reads, 156 experiments
Evidence experimental; cloned [1-3], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-31-3p

Accession MIMAT0004504
Previous IDshsa-miR-31*
Sequence

44 - 

ugcuaugccaacauauugccau

 - 65

Get sequence
Deep sequencing6497 reads, 130 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).