Stem-loop sequence hsa-mir-31

Accession MI0000089
Symbol HGNC:MIR31
Description Homo sapiens miR-31 stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ga     g   c         -u   gaa 
ggagag  ggcaa aug uggcauagc  guu   c
||||||  ||||| ||| |||||||||  |||    
ccuuuc  ccguu uac accguaucg  caa   u
      ua     a   a         uc   ggg 
Get sequence
Deep sequencing
5592 reads, 36 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 21512114-21512184 [-]
sense
OTTHUMT00000051910 ; RP11-354P17.9-001; intron 1
OTTHUMT00000051910 ; RP11-354P17.9-001; intron 1
OTTHUMT00000051910 ; RP11-354P17.9-001; intron 1
ENST00000304425 ; RP11-354P17.9-001; intron 1
ENST00000304425 ; MIR31HG-001; intron 1
ENST00000304425 ; MIR31HG-001; intron 1
Database links

Mature sequence hsa-miR-31-5p

Accession MIMAT0000089
Previous IDs hsa-miR-31
Sequence

8 - 

aggcaagaugcuggcauagcu

 - 28

Get sequence
Deep sequencing 5450 reads, 30 experiments
Evidence experimental; cloned [1-3], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-31-3p

Accession MIMAT0004504
Previous IDs hsa-miR-31*
Sequence

44 - 

ugcuaugccaacauauugccau

 - 65

Get sequence
Deep sequencing 142 reads, 14 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).