Stem-loop sequence hsa-mir-30a

Accession MI0000088
Previous IDs hsa-mir-30
Symbol HGNC:MIR30A
Description Homo sapiens miR-30a stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a            uc           -----   a 
gcg cuguaaacaucc  gacuggaagcu     gug a
||| ||||||||||||  |||||||||||     |||  
cgu gacguuuguagg  cugacuuucgg     cac g
   c            --           guaga   c 
Get sequence
Deep sequencing
196448 reads, 48 experiments
Comments

The mature sequences miR-30 [1] and miR-97 [2] appear to originate from the same precursor. Subsequent data confirm that both arms of the precursor appear to give rise to mature miRNA sequences (Pfeffer S, pers. comm.). Landgraf et al. later showed that the 5' product is the predominant one [5]. Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MI0000441 ; mir-30c-1, MI0000736 ; mir-30c-2, MI0000254 ; mir-30d, MI0000255 ; mir-30e, MI0000749).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 72113254-72113324 [-]
sense
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
OTTHUMT00000041155 ; C6orf155-001; intron 3
OTTHUMT00000041167 ; C6orf155-003; intron 3
ENST00000413945 ; C6orf155-001; intron 3
ENST00000436803 ; C6orf155-003; intron 3
ENST00000413945 ; LINC00472-001; intron 3
ENST00000436803 ; LINC00472-003; intron 3
ENST00000413945 ; LINC00472-001; intron 3
ENST00000436803 ; LINC00472-003; intron 3
Database links

Mature sequence hsa-miR-30a-5p

Accession MIMAT0000087
Previous IDs hsa-miR-30a-5p;hsa-miR-30a
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing 154393 reads, 32 experiments
Evidence experimental; cloned [2,4-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-30a-3p

Accession MIMAT0000088
Previous IDs hsa-miR-30a-3p;hsa-miR-30a*
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Deep sequencing 42055 reads, 36 experiments
Evidence experimental; cloned [1,4-5], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).