Stem-loop sequence hsa-mir-29a

Accession MI0000087
Previous IDs hsa-mir-29
Symbol HGNC:MIR29A
Description Homo sapiens miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
            uuu       c    ucaa 
augacugauuuc   ugguguu agag    u
||||||||||||   ||||||| ||||    a
uauuggcuaaag   accacga ucuu    u
            ucu       -    uuaa 
Get sequence
Deep sequencing
782167 reads, 44 experiments
Comments

miR-29a was previously know as miR-29 here and in [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 130561506-130561569 [-]
sense
ENST00000362111 ; MIR29A-201; exon 1
ENST00000362111 ; MIR29A-201; exon 1
ENST00000362111 ; MIR29A-201; exon 1
antisense
OTTHUMT00000338093 ; AC016831.7-001; intron 2
OTTHUMT00000338093 ; AC016831.7-001; intron 2
OTTHUMT00000338093 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
ENST00000447430 ; AC016831.7-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-29a
hsa-mir-29b-1 chr7: 130562218-130562298 [-]
hsa-mir-29a chr7: 130561506-130561569 [-]
Database links

Mature sequence hsa-miR-29a-5p

Accession MIMAT0004503
Previous IDs hsa-miR-29a*
Sequence

4 - 

acugauuucuuuugguguucag

 - 25

Get sequence
Deep sequencing 309 reads, 14 experiments
Evidence experimental; cloned [6]
Predicted targets

Mature sequence hsa-miR-29a-3p

Accession MIMAT0000086
Previous IDs hsa-miR-29a
Sequence

42 - 

uagcaccaucugaaaucgguua

 - 63

Get sequence
Deep sequencing 781858 reads, 44 experiments
Evidence experimental; cloned [1-3,5-7], Northern [1,4], Solexa [8]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8