Stem-loop sequence hsa-mir-28

AccessionMI0000086 (change log)
Symbol HGNC:MIR28
DescriptionHomo sapiens miR-28 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
      c         a                u  ----     cc 
5' ggu cuugcccuc aggagcucacagucua ug    aguua  u
   ||| ||||||||| |||||||||||||||| ||    |||||   
3' uca ggacgggag uccucgaguguuagau ac    ucagu  u
      c         g                c  ccuu     cu 
Get sequence
Deep sequencing
306554 reads, 4.89e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 188688781-188688866 [+]
sense
OTTHUMT00000343932 ; TPRG1-002; intron 1
ENST00000433971 ; TPRG1-002; intron 1
Database links

Mature sequence hsa-miR-28-5p

Accession MIMAT0000085
Previous IDshsa-miR-28
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing234908 reads, 77 experiments
Evidence experimental; cloned [1-3], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-28-3p

Accession MIMAT0004502
Sequence

54 - 

cacuagauugugagcuccugga

 - 75

Get sequence
Deep sequencing71644 reads, 77 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).