Stem-loop sequence hsa-mir-28

Accession

MI0000086

Symbol

HGNC:MIR28

Description

Homo sapiens miR-28 stem-loop

Gene family

MIPF0000057; mir-28

Stem-loop

   c         a                u  ----     cc 
ggu cuugcccuc aggagcucacagucua ug    aguua  u
||| ||||||||| |||||||||||||||| ||    |||||   
uca ggacgggag uccucgaguguuagau ac    ucagu  u
   c         g                c  ccuu     cu 

Deep sequencing

13091 reads, 47 experiments

Genome context

• Coordinates (GRCh37.p5): chr3: 188406569-188406654 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000344048 ; LPP-019; intron 1

  OTTHUMT00000344048 ; LPP-019; intron 1

  OTTHUMT00000344048 ; LPP-019; intron 1

  OTTHUMT00000344045 ; LPP-016; intron 2

  OTTHUMT00000344045 ; LPP-016; intron 2

  OTTHUMT00000344045 ; LPP-016; intron 2

  OTTHUMT00000344030 ; LPP-001; intron 6

  OTTHUMT00000344031 ; LPP-002; intron 6

  OTTHUMT00000344030 ; LPP-001; intron 6

  OTTHUMT00000344031 ; LPP-002; intron 6

  OTTHUMT00000344030 ; LPP-001; intron 6

  OTTHUMT00000344031 ; LPP-002; intron 6

  ENST00000415906 ; LPP-019; intron 1

  ENST00000415906 ; LPP-019; intron 1

  ENST00000415906 ; LPP-019; intron 1

  ENST00000471917 ; LPP-016; intron 2

  ENST00000471917 ; LPP-016; intron 2

  ENST00000471917 ; LPP-016; intron 2

  ENST00000448637 ; LPP-002; intron 6

  ENST00000312675 ; LPP-001; intron 6

  ENST00000543006 ; LPP-201; intron 6

  ENST00000448637 ; LPP-002; intron 6

  ENST00000312675 ; LPP-001; intron 6

  ENST00000543006 ; LPP-201; intron 6

  ENST00000448637 ; LPP-002; intron 6

  ENST00000312675 ; LPP-001; intron 6

  ENST00000543006 ; LPP-201; intron 6

Database links

• EMBL:AJ421750
• ENTREZGENE: 407020;MIR28
• HGNC: 31615;MIR28

Mature sequence hsa-miR-28-5p

• Accession: MIMAT0000085
• Previous IDs: hsa-miR-28
• Sequence: 14 - aaggagcucacagucuauugag - 35
• Deep sequencing: 5682 reads, 44 experiments
• Evidence: experimental; cloned [1-3], Northern [1]
• Validated targets:
  • MIRECORDS:hsa-miR-28-5p
  • MIRTARBASE:hsa-miR-28-5p
  • TARBASE:hsa-miR-28-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-28-5p
  • MICRORNA.ORG:hsa-miR-28-5p
  • MIRDB:hsa-miR-28-5p
  • RNA22-HSA:hsa-miR-28-5p
  • TARGETMINER:hsa-miR-28-5p
  • TARGETSCAN-VERT:hsa-miR-28-5p
  • PICTAR-VERT:hsa-miR-28

Mature sequence hsa-miR-28-3p

• Accession: MIMAT0004502
• Sequence: 54 - cacuagauugugagcuccugga - 75
• Deep sequencing: 7409 reads, 41 experiments
• Evidence: experimental; cloned [2-4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-28-3p
  • MICRORNA.ORG:hsa-miR-28-3p
  • MIRDB:hsa-miR-28-3p
  • RNA22-HSA:hsa-miR-28-3p
  • TARGETMINER:hsa-miR-28-3p
  • TARGETSCAN-VERT:hsa-miR-28-3p
  • PICTAR-VERT:hsa-miR-28

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).