Stem-loop sequence hsa-mir-27a

Accession

MI0000085

Previous IDs

hsa-mir-27

Symbol

HGNC:MIR27A

Description

Homo sapiens miR-27a stem-loop

Gene family

MIPF0000036; mir-27

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Stem-loop

   a  a  a         ug  u       g  u cac 
cug gg gc gggcuuagc  cu gugagca gg c   a
||| || || |||||||||  || ||||||| || |    
gac cc cg cuugaaucg  ga cacuugu cu g   c
   c  c  c         gu  -       g  - aac 

Deep sequencing

27232 reads, 65 experiments

Comments

This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MI0000440 ).

Genome context

• Coordinates (GRCh37.p5): chr19: 13947254-13947331 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-27a

• hsa-mir-23a: chr19: 13947401-13947473 [-]
• hsa-mir-27a: chr19: 13947254-13947331 [-]
• hsa-mir-24-2: chr19: 13947101-13947173 [-]

Database links

• EMBL:AF480561
• EMBL:AJ421749
• ENTREZGENE: 407018;MIR27A
• HGNC: 31613;MIR27A

Mature sequence hsa-miR-27a-5p

• Accession: MIMAT0004501
• Previous IDs: hsa-miR-27a*
• Sequence: 10 - agggcuuagcugcuugugagca - 31
• Deep sequencing: 373 reads, 13 experiments
• Evidence: experimental; cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-27a-5p
  • MICRORNA.ORG:hsa-miR-27a-5p
  • MIRDB:hsa-miR-27a-5p
  • RNA22-HSA:hsa-miR-27a-5p
  • TARGETMINER:hsa-miR-27a-5p
  • PICTAR-VERT:hsa-miR-27a

Mature sequence hsa-miR-27a-3p

• Accession: MIMAT0000084
• Previous IDs: hsa-miR-27a
• Sequence: 51 - uucacaguggcuaaguuccgc - 71
• Deep sequencing: 26859 reads, 65 experiments
• Evidence: experimental; cloned [1,3-5], Northern [1]
• Validated targets:
  • TARBASE:hsa-miR-27a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-27a-3p
  • MICRORNA.ORG:hsa-miR-27a-3p
  • MIRDB:hsa-miR-27a-3p
  • RNA22-HSA:hsa-miR-27a-3p
  • TARGETMINER:hsa-miR-27a-3p
  • TARGETSCAN-VERT:hsa-miR-27a
  • PICTAR-VERT:hsa-miR-27a

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).