Stem-loop sequence hsa-mir-27a

AccessionMI0000085
Previous IDshsa-mir-27
Symbol HGNC:MIR27A
DescriptionHomo sapiens miR-27a stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      a  a  a         ug  u       g  u cac 
5' cug gg gc gggcuuagc  cu gugagca gg c   a
   ||| || || |||||||||  || ||||||| || |    
3' gac cc cg cuugaaucg  ga cacuugu cu g   c
      c  c  c         gu  -       g  - aac 
Get sequence
Deep sequencing
57536 reads, 7.56e+03 reads per million, 79 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MI0000440).

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 13836440-13836517 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-27a
hsa-mir-23achr19: 13836587-13836659 [-]
hsa-mir-27achr19: 13836440-13836517 [-]
hsa-mir-24-2chr19: 13836287-13836359 [-]
Database links

Mature sequence hsa-miR-27a-5p

Accession MIMAT0004501
Previous IDshsa-miR-27a*
Sequence

10 - 

agggcuuagcugcuugugagca

 - 31

Get sequence
Deep sequencing964 reads, 40 experiments
Evidence experimental; cloned [4]
Predicted targets

Mature sequence hsa-miR-27a-3p

Accession MIMAT0000084
Previous IDshsa-miR-27a
Sequence

51 - 

uucacaguggcuaaguuccgc

 - 71

Get sequence
Deep sequencing773 reads, 57 experiments
Evidence experimental; cloned [1,3-5], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).