Stem-loop sequence hsa-mir-26b

Accession MI0000084
Symbol HGNC:MIR26B
Description Homo sapiens miR-26b stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    ga   -   u        uc           u ug 
ccgg  ccc agu caaguaau  aggauagguug g  c
||||  ||| ||| ||||||||  ||||||||||| |   
ggcc  ggg ucg guucauua  ucuuguccgac c  u
    ag   c   -        cc           - ug 
Get sequence
Deep sequencing
47900 reads, 37 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 219267369-219267445 [+]
sense
OTTHUMT00000338198 ; CTDSP1-010; intron 3
OTTHUMT00000338198 ; CTDSP1-010; intron 3
OTTHUMT00000338198 ; CTDSP1-010; intron 3
OTTHUMT00000338202 ; CTDSP1-014; intron 4
OTTHUMT00000338190 ; CTDSP1-002; intron 4
OTTHUMT00000338192 ; CTDSP1-004; intron 4
OTTHUMT00000256774 ; CTDSP1-001; intron 4
OTTHUMT00000338194 ; CTDSP1-006; intron 4
OTTHUMT00000338200 ; CTDSP1-012; intron 4
OTTHUMT00000338199 ; CTDSP1-011; intron 4
OTTHUMT00000338197 ; CTDSP1-009; intron 4
OTTHUMT00000338203 ; CTDSP1-015; intron 4
OTTHUMT00000338202 ; CTDSP1-014; intron 4
OTTHUMT00000338190 ; CTDSP1-002; intron 4
OTTHUMT00000338192 ; CTDSP1-004; intron 4
OTTHUMT00000256774 ; CTDSP1-001; intron 4
OTTHUMT00000338194 ; CTDSP1-006; intron 4
OTTHUMT00000338200 ; CTDSP1-012; intron 4
OTTHUMT00000338199 ; CTDSP1-011; intron 4
OTTHUMT00000338197 ; CTDSP1-009; intron 4
OTTHUMT00000338203 ; CTDSP1-015; intron 4
OTTHUMT00000338202 ; CTDSP1-014; intron 4
OTTHUMT00000338190 ; CTDSP1-002; intron 4
OTTHUMT00000338192 ; CTDSP1-004; intron 4
OTTHUMT00000256774 ; CTDSP1-001; intron 4
OTTHUMT00000338194 ; CTDSP1-006; intron 4
OTTHUMT00000338200 ; CTDSP1-012; intron 4
OTTHUMT00000338199 ; CTDSP1-011; intron 4
OTTHUMT00000338197 ; CTDSP1-009; intron 4
OTTHUMT00000338203 ; CTDSP1-015; intron 4
OTTHUMT00000338193 ; CTDSP1-005; intron 5
OTTHUMT00000338193 ; CTDSP1-005; intron 5
OTTHUMT00000338193 ; CTDSP1-005; intron 5
ENST00000482272 ; CTDSP1-010; intron 3
ENST00000482272 ; CTDSP1-010; intron 3
ENST00000482272 ; CTDSP1-010; intron 3
ENST00000491064 ; CTDSP1-014; intron 4
ENST00000443891 ; CTDSP1-002; intron 4
ENST00000473420 ; CTDSP1-004; intron 4
ENST00000273062 ; CTDSP1-001; intron 4
ENST00000497677 ; CTDSP1-006; intron 4
ENST00000452977 ; CTDSP1-012; intron 4
ENST00000428361 ; CTDSP1-011; intron 4
ENST00000488627 ; CTDSP1-009; intron 4
ENST00000464255 ; CTDSP1-015; intron 4
ENST00000491064 ; CTDSP1-014; intron 4
ENST00000443891 ; CTDSP1-002; intron 4
ENST00000473420 ; CTDSP1-004; intron 4
ENST00000273062 ; CTDSP1-001; intron 4
ENST00000497677 ; CTDSP1-006; intron 4
ENST00000452977 ; CTDSP1-012; intron 4
ENST00000428361 ; CTDSP1-011; intron 4
ENST00000488627 ; CTDSP1-009; intron 4
ENST00000464255 ; CTDSP1-015; intron 4
ENST00000491064 ; CTDSP1-014; intron 4
ENST00000443891 ; CTDSP1-002; intron 4
ENST00000473420 ; CTDSP1-004; intron 4
ENST00000273062 ; CTDSP1-001; intron 4
ENST00000497677 ; CTDSP1-006; intron 4
ENST00000452977 ; CTDSP1-012; intron 4
ENST00000428361 ; CTDSP1-011; intron 4
ENST00000488627 ; CTDSP1-009; intron 4
ENST00000464255 ; CTDSP1-015; intron 4
ENST00000498160 ; CTDSP1-005; intron 5
ENST00000498160 ; CTDSP1-005; intron 5
ENST00000498160 ; CTDSP1-005; intron 5
Database links

Mature sequence hsa-miR-26b-5p

Accession MIMAT0000083
Previous IDs hsa-miR-26b
Sequence

12 - 

uucaaguaauucaggauaggu

 - 32

Get sequence
Deep sequencing 47897 reads, 37 experiments
Evidence experimental; cloned [1,3-5], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-26b-3p

Accession MIMAT0004500
Previous IDs hsa-miR-26b*
Sequence

47 - 

ccuguucuccauuacuuggcuc

 - 68

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).