Stem-loop sequence hsa-mir-26a-1

Accession MI0000083
Previous IDs hsa-mir-26a
Symbol HGNC:MIR26A1
Description Homo sapiens miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g      u         c          --g  ca 
gug ccucgu caaguaauc aggauaggcu   ug  g
||| |||||| ||||||||| ||||||||||   ||  g
cgc ggggca guucauugg ucuuauccgg   ac  u
   a      c         u          gua  cc 
Get sequence
Deep sequencing
53192 reads, 46 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 38010895-38010971 [+]
sense
OTTHUMT00000342397 ; CTDSPL-008; intron 2
OTTHUMT00000342397 ; CTDSPL-008; intron 2
OTTHUMT00000342397 ; CTDSPL-008; intron 2
OTTHUMT00000342399 ; CTDSPL-002; intron 4
OTTHUMT00000342394 ; CTDSPL-005; intron 4
OTTHUMT00000342399 ; CTDSPL-002; intron 4
OTTHUMT00000342394 ; CTDSPL-005; intron 4
OTTHUMT00000342399 ; CTDSPL-002; intron 4
OTTHUMT00000342394 ; CTDSPL-005; intron 4
OTTHUMT00000342392 ; CTDSPL-001; intron 5
OTTHUMT00000342393 ; CTDSPL-004; intron 5
OTTHUMT00000342392 ; CTDSPL-001; intron 5
OTTHUMT00000342393 ; CTDSPL-004; intron 5
OTTHUMT00000342392 ; CTDSPL-001; intron 5
OTTHUMT00000342393 ; CTDSPL-004; intron 5
ENST00000447745 ; CTDSPL-008; intron 2
ENST00000447745 ; CTDSPL-008; intron 2
ENST00000447745 ; CTDSPL-008; intron 2
ENST00000443503 ; CTDSPL-002; intron 4
ENST00000310189 ; CTDSPL-005; intron 4
ENST00000443503 ; CTDSPL-002; intron 4
ENST00000310189 ; CTDSPL-005; intron 4
ENST00000443503 ; CTDSPL-002; intron 4
ENST00000310189 ; CTDSPL-005; intron 4
ENST00000273179 ; CTDSPL-001; intron 5
ENST00000486978 ; CTDSPL-004; intron 5
ENST00000273179 ; CTDSPL-001; intron 5
ENST00000486978 ; CTDSPL-004; intron 5
ENST00000273179 ; CTDSPL-001; intron 5
ENST00000486978 ; CTDSPL-004; intron 5
Database links

Mature sequence hsa-miR-26a-5p

Accession MIMAT0000082
Previous IDs hsa-miR-26a
Sequence

10 - 

uucaaguaauccaggauaggcu

 - 31

Get sequence
Deep sequencing 110323 reads, 58 experiments
Evidence experimental; cloned [1,4-7], Northern [1,3]
Validated targets
Predicted targets

Mature sequence hsa-miR-26a-1-3p

Accession MIMAT0004499
Previous IDs hsa-miR-26a-1*
Sequence

49 - 

ccuauucuugguuacuugcacg

 - 70

Get sequence
Deep sequencing 9 reads, 4 experiments
Evidence experimental; cloned [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).