Stem-loop sequence hsa-mir-25

AccessionMI0000082 (change log)
Symbol HGNC:MIR25
DescriptionHomo sapiens miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

252 open access papers mention hsa-mir-25
(914 sentences)

Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Deep sequencing
1278112 reads, 3.12e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 100093560-100093643 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-25
hsa-mir-106bchr7: 100093993-100094074 [-]
hsa-mir-93chr7: 100093768-100093847 [-]
hsa-mir-25chr7: 100093560-100093643 [-]
Database links

Mature sequence hsa-miR-25-5p

Accession MIMAT0004498
Previous IDshsa-miR-25*
Sequence

14 - 

aggcggagacuugggcaauug

 - 34

Get sequence
Deep sequencing68019 reads, 141 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-25-3p

Accession MIMAT0000081
Previous IDshsa-miR-25
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing1210086 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [1]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).