Stem-loop sequence hsa-mir-24-2

Accession

MI0000081

Symbol

HGNC:MIR24-2

Description

Homo sapiens miR-24-2 stem-loop

Gene family

MIPF0000041; mir-24

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Stem-loop

     cc   cg   -cu         --aa      u 
cucug  ucc  ugc   acugagcug    acacag u
|||||  |||  |||   |||||||||    |||||| g
gggac  agg  acg   ugacucggu    uguguu g
     -a   --   acu         caca      u 

Deep sequencing

69897 reads, 52 experiments

Comments

mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].

Genome context

• Coordinates (GRCh37.p5): chr19: 13947101-13947173 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-24-2

• hsa-mir-23a: chr19: 13947401-13947473 [-]
• hsa-mir-27a: chr19: 13947254-13947331 [-]
• hsa-mir-24-2: chr19: 13947101-13947173 [-]

Database links

• EMBL: AF480559;AF480559
• EMBL: AJ421745;AJ421745
• ENTREZGENE: 407013;MIR24-2
• HGNC: 31608;MIR24-2

Mature sequence hsa-miR-24-2-5p

• Accession: MIMAT0004497
• Previous IDs: hsa-miR-24-2*
• Sequence: 13 - ugccuacugagcugaaacacag - 34
• Deep sequencing: 423 reads, 28 experiments
• Evidence: experimental; cloned [6]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-24-2-5p
  • MICRORNA.ORG:hsa-miR-24-2-5p
  • MIRDB:hsa-miR-24-2-5p
  • RNA22-HSA:hsa-miR-24-2-5p
  • TARGETMINER:hsa-miR-24-2-5p
  • PICTAR-VERT:hsa-miR-24

Mature sequence hsa-miR-24-3p

• Accession: MIMAT0000080
• Previous IDs: hsa-miR-24
• Sequence: 50 - uggcucaguucagcaggaacag - 71
• Deep sequencing: 139200 reads, 52 experiments
• Evidence: experimental; cloned [1,4-7], Northern [1], Solexa [8]
• Validated targets:
  • TARBASE:hsa-miR-24-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-24-3p
  • MICRORNA.ORG:hsa-miR-24-3p
  • MIRDB:hsa-miR-24-3p
  • RNA22-HSA:hsa-miR-24-3p
  • TARGETMINER:hsa-miR-24-3p
  • TARGETSCAN-VERT:hsa-miR-24
  • PICTAR-VERT:hsa-miR-24

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).