Stem-loop sequence hsa-mir-24-2

AccessionMI0000081 (change log)
Symbol HGNC:MIR24-2
DescriptionHomo sapiens miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

343 open access papers mention hsa-mir-24-2
(2123 sentences)

Stem-loop
        cc   cg   -cu         --aa      u 
5' cucug  ucc  ugc   acugagcug    acacag u
   |||||  |||  |||   |||||||||    |||||| g
3' gggac  agg  acg   ugacucggu    uguguu g
        -a   --   acu         caca      u 
Get sequence
Deep sequencing
1987325 reads, 3.75e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 13836287-13836359 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-24-2
hsa-mir-23achr19: 13836587-13836659 [-]
hsa-mir-27achr19: 13836440-13836517 [-]
hsa-mir-24-2chr19: 13836287-13836359 [-]
Database links

Mature sequence hsa-miR-24-2-5p

Accession MIMAT0004497
Previous IDshsa-miR-24-2*
Sequence

13 - 

ugccuacugagcugaaacacag

 - 34

Get sequence
Deep sequencing18967 reads, 153 experiments
Evidence experimental; cloned [6]
Database links
Predicted targets

Mature sequence hsa-miR-24-3p

Accession MIMAT0000080
Previous IDshsa-miR-24
Sequence

50 - 

uggcucaguucagcaggaacag

 - 71

Get sequence
Deep sequencing3941768 reads, 159 experiments
Evidence experimental; cloned [1,4-7], Northern [1], Illumina [8]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8