Stem-loop sequence hsa-mir-24-1

AccessionMI0000080 (change log)
Symbol HGNC:MIR24-1
DescriptionHomo sapiens miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

347 open access papers mention hsa-mir-24-1
(2046 sentences)

Stem-loop
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacau 
Get sequence
Deep sequencing
1986473 reads, 3.72e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 95086021-95086088 [+]
antisense
OTTHUMT00000053075 ; NOL8-003; intron 1
OTTHUMT00000053082 ; NOL8-010; intron 1
OTTHUMT00000053080 ; NOL8-008; intron 1
OTTHUMT00000402688 ; NOL8-020; intron 1
OTTHUMT00000402689 ; NOL8-018; intron 1
OTTHUMT00000053078 ; NOL8-006; intron 2
OTTHUMT00000402683 ; NOL8-016; intron 2
OTTHUMT00000402684 ; NOL8-015; intron 2
OTTHUMT00000402685 ; NOL8-017; intron 2
OTTHUMT00000053076 ; NOL8-004; intron 2
OTTHUMT00000053077 ; NOL8-005; intron 2
OTTHUMT00000402687 ; NOL8-013; intron 2
OTTHUMT00000053079 ; NOL8-007; intron 2
OTTHUMT00000402693 ; NOL8-028; intron 2
OTTHUMT00000402690 ; NOL8-019; intron 2
OTTHUMT00000402691 ; NOL8-027; intron 2
OTTHUMT00000402692 ; NOL8-025; intron 2
OTTHUMT00000402694 ; NOL8-026; intron 2
OTTHUMT00000402695 ; NOL8-024; intron 2
OTTHUMT00000402696 ; NOL8-021; intron 2
OTTHUMT00000402697 ; NOL8-022; intron 2
OTTHUMT00000053074 ; NOL8-002; intron 2
OTTHUMT00000402698 ; NOL8-023; intron 2
OTTHUMT00000402682 ; NOL8-012; intron 3
ENST00000360868 ; NOL8-003; intron 1
ENST00000535387 ; NOL8-010; intron 1
ENST00000542053 ; NOL8-008; intron 1
ENST00000411621 ; NOL8-020; intron 1
ENST00000535807 ; NOL8-018; intron 1
ENST00000442668 ; NOL8-006; intron 2
ENST00000536593 ; NOL8-016; intron 2
ENST00000545558 ; NOL8-015; intron 2
ENST00000544867 ; NOL8-017; intron 2
ENST00000432670 ; NOL8-004; intron 2
ENST00000434228 ; NOL8-005; intron 2
ENST00000433029 ; NOL8-013; intron 2
ENST00000421075 ; NOL8-007; intron 2
ENST00000445919 ; NOL8-028; intron 2
ENST00000536624 ; NOL8-019; intron 2
ENST00000542613 ; NOL8-027; intron 2
ENST00000542573 ; NOL8-025; intron 2
ENST00000543260 ; NOL8-026; intron 2
ENST00000543985 ; NOL8-024; intron 2
ENST00000544321 ; NOL8-021; intron 2
ENST00000538215 ; NOL8-022; intron 2
ENST00000482475 ; NOL8-002; intron 2
ENST00000535649 ; NOL8-023; intron 2
ENST00000358855 ; NOL8-201; intron 2
ENST00000545444 ; NOL8-012; intron 3
Clustered miRNAs
< 10kb from hsa-mir-24-1
hsa-mir-23bchr9: 95085208-95085304 [+]
hsa-mir-27bchr9: 95085445-95085541 [+]
hsa-mir-3074chr9: 95086014-95086094 [-]
hsa-mir-24-1chr9: 95086021-95086088 [+]
Database links

Mature sequence hsa-miR-24-1-5p

Accession MIMAT0000079
Previous IDshsa-miR-189;hsa-miR-24-1*
Sequence

7 - 

ugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing13034 reads, 149 experiments
Evidence experimental; cloned [7]
Database links
Predicted targets

Mature sequence hsa-miR-24-3p

Accession MIMAT0000080
Previous IDshsa-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing3941768 reads, 159 experiments
Evidence experimental; cloned [1,4-7], Northern [1], Illumina [8]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
4
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
9