Stem-loop sequence hsa-mir-23a

AccessionMI0000079
Previous IDshsa-mir-23
Symbol HGNC:MIR23A
DescriptionHomo sapiens miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
     c   c     -       g    g      cuuc 
5' gg cgg ugggg uuccugg gaug gauuug    c
   || ||| ||||| ||||||| |||| ||||||     
3' cc gcc accuu agggacc uuac cuaaac    u
     a   a     u       g    a      acug 
Get sequence
Deep sequencing
110793 reads, 1.69e+04 reads per million, 80 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was previously named miR-23 [1,2] but is renamed here to avoid confusion with the more recently described miR-23b (MI0000439). Kawasaki and Taira reported that miR-23 regulates the transcriptional repressor Hairy enhancer of split (HES1) [3]. This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 13836587-13836659 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-23a
hsa-mir-23achr19: 13836587-13836659 [-]
hsa-mir-27achr19: 13836440-13836517 [-]
hsa-mir-24-2chr19: 13836287-13836359 [-]
Database links

Mature sequence hsa-miR-23a-5p

Accession MIMAT0004496
Previous IDshsa-miR-23a*
Sequence

9 - 

gggguuccuggggaugggauuu

 - 30

Get sequence
Deep sequencing244 reads, 34 experiments
Evidence experimental; cloned [6-7]
Predicted targets

Mature sequence hsa-miR-23a-3p

Accession MIMAT0000078
Previous IDshsa-miR-23a
Sequence

45 - 

aucacauugccagggauuucc

 - 65

Get sequence
Deep sequencing3160 reads, 73 experiments
Evidence experimental; cloned [1,4-7], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
4
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).