Stem-loop sequence hsa-mir-22

AccessionMI0000078 (change log)
Symbol HGNC:MIR22
DescriptionHomo sapiens miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

294 open access papers mention hsa-mir-22
(1719 sentences)

Stem-loop
      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 
Get sequence
Deep sequencing
1291263 reads, 3.83e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 1713903-1713987 [-]
sense
OTTHUMT00000207108 ; SMYD4-001; intron 3
OTTHUMT00000438278 ; SMYD4-005; intron 3
OTTHUMT00000318358 ; SMYD4-003; intron 3
OTTHUMT00000438279 ; SMYD4-007; intron 3
ENST00000305513 ; SMYD4-001; intron 3
ENST00000570368 ; SMYD4-005; intron 3
ENST00000571854 ; SMYD4-003; intron 3
ENST00000573937 ; SMYD4-007; intron 3
Database links

Mature sequence hsa-miR-22-5p

Accession MIMAT0004495
Previous IDshsa-miR-22*
Sequence

15 - 

aguucuucaguggcaagcuuua

 - 36

Get sequence
Deep sequencing36288 reads, 153 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-22-3p

Accession MIMAT0000077
Previous IDshsa-miR-22
Sequence

53 - 

aagcugccaguugaagaacugu

 - 74

Get sequence
Deep sequencing1254963 reads, 159 experiments
Evidence experimental; cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6