Stem-loop sequence hsa-mir-22

AccessionMI0000078 (change log)
Symbol HGNC:MIR22
DescriptionHomo sapiens miR-22 stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 
Get sequence
Deep sequencing
250303 reads, 4.3e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 1713903-1713987 [-]
sense
OTTHUMT00000207108 ; SMYD4-001; intron 3
OTTHUMT00000438278 ; SMYD4-005; intron 3
OTTHUMT00000318358 ; SMYD4-003; intron 3
OTTHUMT00000438279 ; SMYD4-007; intron 3
ENST00000305513 ; SMYD4-001; intron 3
ENST00000570368 ; SMYD4-005; intron 3
ENST00000571854 ; SMYD4-003; intron 3
ENST00000573937 ; SMYD4-007; intron 3
Database links

Mature sequence hsa-miR-22-5p

Accession MIMAT0004495
Previous IDshsa-miR-22*
Sequence

15 - 

aguucuucaguggcaagcuuua

 - 36

Get sequence
Deep sequencing9957 reads, 71 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-22-3p

Accession MIMAT0000077
Previous IDshsa-miR-22
Sequence

53 - 

aagcugccaguugaagaacugu

 - 74

Get sequence
Deep sequencing240355 reads, 77 experiments
Evidence experimental; cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6