Stem-loop sequence hsa-mir-22

Accession MI0000078
Symbol HGNC:MIR22
Description Homo sapiens miR-22 stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   cc               -     a      u  ccu 
ggc gag  gcaguaguucuucag uggca gcuuua gu   g
||| |||  ||||||||||||||| ||||| |||||| ||   a
ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
   u   -c               g     -      -  acc 
Get sequence
Deep sequencing
32077 reads, 33 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 1617197-1617281 [-]
sense
OTTHUMT00000438299 ; MIR22HG-002; exon 2
OTTHUMT00000438375 ; MIR22HG-012; exon 2
OTTHUMT00000438300 ; MIR22HG-003; exon 2
OTTHUMT00000438376 ; MIR22HG-011; exon 2
OTTHUMT00000438302 ; MIR22HG-006; exon 2
OTTHUMT00000438299 ; MIR22HG-002; exon 2
OTTHUMT00000438375 ; MIR22HG-012; exon 2
OTTHUMT00000438300 ; MIR22HG-003; exon 2
OTTHUMT00000438376 ; MIR22HG-011; exon 2
OTTHUMT00000438302 ; MIR22HG-006; exon 2
OTTHUMT00000255250 ; C17orf91-001; exon 3
OTTHUMT00000255250 ; MIR22HG-001; exon 3
OTTHUMT00000438374 ; MIR22HG-010; exon 3
OTTHUMT00000438301 ; MIR22HG-004; exon 3
OTTHUMT00000438377 ; MIR22HG-009; exon 3
OTTHUMT00000438378 ; MIR22HG-008; exon 3
OTTHUMT00000438379 ; MIR22HG-007; exon 3
OTTHUMT00000255250 ; MIR22HG-001; exon 3
OTTHUMT00000438374 ; MIR22HG-010; exon 3
OTTHUMT00000438301 ; MIR22HG-004; exon 3
OTTHUMT00000438377 ; MIR22HG-009; exon 3
OTTHUMT00000438378 ; MIR22HG-008; exon 3
OTTHUMT00000438379 ; MIR22HG-007; exon 3
OTTHUMT00000438303 ; MIR22HG-005; exon 4
OTTHUMT00000438303 ; MIR22HG-005; exon 4
ENST00000362190 ; MIR22-201; exon 1
ENST00000362190 ; MIR22-201; exon 1
ENST00000362190 ; MIR22-201; exon 1
ENST00000574306 ; MIR22HG-002; exon 2
ENST00000570416 ; MIR22HG-012; exon 2
ENST00000571595 ; MIR22HG-003; exon 2
ENST00000571091 ; MIR22HG-011; exon 2
ENST00000575626 ; MIR22HG-006; exon 2
ENST00000574306 ; MIR22HG-002; exon 2
ENST00000570416 ; MIR22HG-012; exon 2
ENST00000571595 ; MIR22HG-003; exon 2
ENST00000571091 ; MIR22HG-011; exon 2
ENST00000575626 ; MIR22HG-006; exon 2
ENST00000334146 ; C17orf91-001; exon 3
ENST00000334146 ; MIR22HG-001; exon 3
ENST00000576749 ; MIR22HG-010; exon 3
ENST00000573127 ; MIR22HG-004; exon 3
ENST00000576489 ; MIR22HG-009; exon 3
ENST00000573075 ; MIR22HG-008; exon 3
ENST00000574016 ; MIR22HG-007; exon 3
ENST00000334146 ; MIR22HG-001; exon 3
ENST00000576749 ; MIR22HG-010; exon 3
ENST00000573127 ; MIR22HG-004; exon 3
ENST00000576489 ; MIR22HG-009; exon 3
ENST00000573075 ; MIR22HG-008; exon 3
ENST00000574016 ; MIR22HG-007; exon 3
ENST00000577164 ; MIR22HG-005; exon 4
ENST00000577164 ; MIR22HG-005; exon 4
Database links

Mature sequence hsa-miR-22-5p

Accession MIMAT0004495
Previous IDs hsa-miR-22*
Sequence

15 - 

aguucuucaguggcaagcuuua

 - 36

Get sequence
Deep sequencing 1437 reads, 18 experiments
Evidence experimental; cloned [4]
Predicted targets

Mature sequence hsa-miR-22-3p

Accession MIMAT0000077
Previous IDs hsa-miR-22
Sequence

53 - 

aagcugccaguugaagaacugu

 - 74

Get sequence
Deep sequencing 30640 reads, 33 experiments
Evidence experimental; cloned [1,3-5], Northern [1], Solexa [6]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6