Stem-loop sequence hsa-mir-21

Accession MI0000077
Symbol HGNC:MIR21
Description Homo sapiens miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     gu        a     a     a    u a 
 gucgg  agcuuauc gacug uguug cugu g a
 |||||  |||||||| ||||| ||||| |||| | u
 caguc  ucggguag cugac acaac ggua c c
a     ug        -     c     -    - u 
Get sequence
Deep sequencing
625461 reads, 53 experiments
Comments

Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 57918627-57918698 [+]
intergenic
Database links

Mature sequence hsa-miR-21-5p

Accession MIMAT0000076
Previous IDs hsa-miR-21
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing 618189 reads, 49 experiments
Evidence experimental; cloned [1-3,6-9], Northern [1,5], Solexa [10]
Validated targets
Predicted targets

Mature sequence hsa-miR-21-3p

Accession MIMAT0004494
Previous IDs hsa-miR-21*
Sequence

46 - 

caacaccagucgaugggcugu

 - 66

Get sequence
Deep sequencing 7272 reads, 34 experiments
Evidence experimental; cloned [8-9]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
10