Stem-loop sequence hsa-mir-21

AccessionMI0000077
Symbol HGNC:MIR21
DescriptionHomo sapiens miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     c     -    - u 
Get sequence
Deep sequencing
528922 reads, 2.56e+04 reads per million, 81 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 59841266-59841337 [+]
antisense
OTTHUMT00000445364 ; BRIP1-006; intron 1
OTTHUMT00000445363 ; BRIP1-002; intron 13
OTTHUMT00000445362 ; BRIP1-001; intron 14
ENST00000584322 ; BRIP1-006; intron 1
ENST00000577598 ; BRIP1-002; intron 13
ENST00000259008 ; BRIP1-001; intron 14
Database links

Mature sequence hsa-miR-21-5p

Accession MIMAT0000076
Previous IDshsa-miR-21
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing10446 reads, 72 experiments
Evidence experimental; cloned [1-3,6-9], Northern [1,5], Illumina [10]
Validated targets
Predicted targets

Mature sequence hsa-miR-21-3p

Accession MIMAT0004494
Previous IDshsa-miR-21*
Sequence

46 - 

caacaccagucgaugggcugu

 - 66

Get sequence
Deep sequencing3950 reads, 53 experiments
Evidence experimental; cloned [8-9]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
10