Stem-loop sequence hsa-mir-20a

AccessionMI0000076 (change log)
Previous IDshsa-mir-20
Symbol HGNC:MIR20A
DescriptionHomo sapiens miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

463 open access papers mention hsa-mir-20a
(1933 sentences)

Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Deep sequencing
1953373 reads, 7.48e+03 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91351065-91351135 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-20a
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-20a-5p

Accession MIMAT0000075
Previous IDshsa-miR-20;hsa-miR-20a
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Deep sequencing1925290 reads, 156 experiments
Evidence experimental; cloned [1,4-7], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-20a-3p

Accession MIMAT0004493
Previous IDshsa-miR-20a*
Sequence

44 - 

acugcauuaugagcacuuaaag

 - 65

Get sequence
Deep sequencing28082 reads, 154 experiments
Evidence experimental; cloned [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).