Stem-loop sequence hsa-mir-20a

AccessionMI0000076
Previous IDshsa-mir-20
Symbol HGNC:MIR20A
DescriptionHomo sapiens miR-20a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Deep sequencing
8073 reads, 4.21e+03 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr13: 91351065-91351135 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-20a
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-20a-5p

Accession MIMAT0000075
Previous IDshsa-miR-20;hsa-miR-20a
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Deep sequencing1132 reads, 60 experiments
Evidence experimental; cloned [1,4-7], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-20a-3p

Accession MIMAT0004493
Previous IDshsa-miR-20a*
Sequence

44 - 

acugcauuaugagcacuuaaag

 - 65

Get sequence
Deep sequencing655 reads, 43 experiments
Evidence experimental; cloned [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).