Stem-loop sequence hsa-mir-19b-1

AccessionMI0000074 (change log)
Symbol HGNC:MIR19B1
DescriptionHomo sapiens miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Literature search

302 open access papers mention hsa-mir-19b-1
(1292 sentences)

Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Deep sequencing
1908018 reads, 1.13e+04 reads per million, 162 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91351192-91351278 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-19b-1
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-19b-1-5p

Accession MIMAT0004491
Previous IDshsa-miR-19b-1*
Sequence

16 - 

aguuuugcagguuugcauccagc

 - 38

Get sequence
Deep sequencing19171 reads, 138 experiments
Evidence experimental; cloned [8]
Database links
Predicted targets

Mature sequence hsa-miR-19b-3p

Accession MIMAT0000074
Previous IDshsa-miR-19b
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing3890764 reads, 159 experiments
Evidence experimental; cloned [1-3,6-9], Northern [1,5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).