Stem-loop sequence hsa-mir-19a

AccessionMI0000073 (change log)
Symbol HGNC:MIR19A
DescriptionHomo sapiens miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

313 open access papers mention hsa-mir-19a
(1573 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
1697482 reads, 1.06e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91350891-91350972 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-19a
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-19a-5p

Accession MIMAT0004490
Previous IDshsa-miR-19a*
Sequence

14 - 

aguuuugcauaguugcacuaca

 - 35

Get sequence
Deep sequencing4992 reads, 58 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-19a-3p

Accession MIMAT0000073
Previous IDshsa-miR-19a
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing1692402 reads, 159 experiments
Evidence experimental; cloned [1-5], Northern [1]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).