Stem-loop sequence hsa-mir-18a

Accession MI0000072
Previous IDs hsa-mir-18
Symbol HGNC:MIR18A
Description Homo sapiens miR-18a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   cu    u   uc   u    a   -  aa u 
 guu  aagg gca  uag gcag uag ug  g a
 |||  |||| |||  ||| |||| ||| ||  | g
 cgg  uucc cgu  auc cguc auc ac  u a
a   uc    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
2779 reads, 34 experiments
Comments

This sequence maps to chromosome 13 and is named miR-18 precursor-13 in reference [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 92003005-92003075 [+]
sense
OTTHUMT00000045444 ; RP11-282D2.3-001; exon 1
OTTHUMT00000045444 ; RP11-282D2.3-001; exon 1
OTTHUMT00000442497 ; MIR17HG-002; exon 2
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000442498 ; MIR17HG-003; exon 3
ENST00000362310 ; MIR18A-201; exon 1
ENST00000454574 ; RP11-282D2.3-001; exon 1
ENST00000362310 ; MIR18A-201; exon 1
ENST00000454574 ; RP11-282D2.3-001; exon 1
ENST00000362310 ; MIR18A-201; exon 1
ENST00000582141 ; MIR17HG-002; exon 2
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000581816 ; MIR17HG-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-18a
hsa-mir-17 chr13: 92002859-92002942 [+]
hsa-mir-18a chr13: 92003005-92003075 [+]
hsa-mir-19a chr13: 92003145-92003226 [+]
hsa-mir-20a chr13: 92003319-92003389 [+]
hsa-mir-19b-1 chr13: 92003446-92003532 [+]
hsa-mir-92a-1 chr13: 92003568-92003645 [+]
Database links

Mature sequence hsa-miR-18a-5p

Accession MIMAT0000072
Previous IDs hsa-miR-18;hsa-miR-18a
Sequence

6 - 

uaaggugcaucuagugcagauag

 - 28

Get sequence
Deep sequencing 2715 reads, 34 experiments
Evidence experimental; cloned [1,3-6], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-18a-3p

Accession MIMAT0002891
Previous IDs hsa-miR-18a*
Sequence

47 - 

acugcccuaagugcuccuucugg

 - 69

Get sequence
Deep sequencing 64 reads, 12 experiments
Evidence experimental; cloned [4-6]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).