Stem-loop sequence hsa-mir-18a

AccessionMI0000072 (change log)
Previous IDshsa-mir-18
Symbol HGNC:MIR18A
DescriptionHomo sapiens miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

274 open access papers mention hsa-mir-18a
(819 sentences)

Stem-loop
   u   cu    u   uc   u    a   -  aa u 
5'  guu  aagg gca  uag gcag uag ug  g a
    |||  |||| |||  ||| |||| ||| ||  | g
3'  cgg  uucc cgu  auc cguc auc ac  u a
   a   uc    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
736430 reads, 3.06e+03 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence maps to chromosome 13 and is named miR-18 precursor-13 in reference [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91350751-91350821 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-18a
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-18a-5p

Accession MIMAT0000072
Previous IDshsa-miR-18;hsa-miR-18a
Sequence

6 - 

uaaggugcaucuagugcagauag

 - 28

Get sequence
Deep sequencing702681 reads, 156 experiments
Evidence experimental; cloned [1,3-6], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-18a-3p

Accession MIMAT0002891
Previous IDshsa-miR-18a*
Sequence

47 - 

acugcccuaagugcuccuucugg

 - 69

Get sequence
Deep sequencing33689 reads, 120 experiments
Evidence experimental; cloned [4-6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).