Stem-loop sequence hsa-mir-17

AccessionMI0000071 (change log)
Symbol HGNC:MIR17
DescriptionHomo sapiens miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

756 open access papers mention hsa-mir-17
(4156 sentences)

Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  a
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Deep sequencing
2699111 reads, 9.52e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 91350605-91350688 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-17
hsa-mir-17chr13: 91350605-91350688 [+]
hsa-mir-18achr13: 91350751-91350821 [+]
hsa-mir-19achr13: 91350891-91350972 [+]
hsa-mir-20achr13: 91351065-91351135 [+]
hsa-mir-19b-1chr13: 91351192-91351278 [+]
hsa-mir-92a-1chr13: 91351314-91351391 [+]
Database links

Mature sequence hsa-miR-17-5p

Accession MIMAT0000070
Previous IDshsa-miR-17-5p;hsa-miR-17
Sequence

14 - 

caaagugcuuacagugcagguag

 - 36

Get sequence
Deep sequencing2537273 reads, 159 experiments
Evidence experimental; cloned [2,5-8], Northern [4]
Database links
Predicted targets

Mature sequence hsa-miR-17-3p

Accession MIMAT0000071
Previous IDshsa-miR-17-3p;hsa-miR-17*
Sequence

51 - 

acugcagugaaggcacuuguag

 - 72

Get sequence
Deep sequencing161676 reads, 159 experiments
Evidence experimental; cloned [1,5,7-8], Northern [1]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).