Stem-loop sequence hsa-mir-17

Accession MI0000071
Symbol HGNC:MIR17
Description Homo sapiens miR-17 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    ga       -ca        a  g     g   -  au 
guca  auaaugu   aagugcuu ca ugcag uag ug  a
||||  |||||||   |||||||| || ||||| ||| ||  u
cagu  uauuacg   uucacgga gu acguc auc ac  g
    gg       aug        a  g     -   u  gu 
Get sequence
Deep sequencing
35854 reads, 48 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 92002859-92002942 [+]
sense
OTTHUMT00000442497 ; MIR17HG-002; exon 2
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000442498 ; MIR17HG-003; exon 3
ENST00000582141 ; MIR17HG-002; exon 2
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000581816 ; MIR17HG-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-17
hsa-mir-17 chr13: 92002859-92002942 [+]
hsa-mir-18a chr13: 92003005-92003075 [+]
hsa-mir-19a chr13: 92003145-92003226 [+]
hsa-mir-20a chr13: 92003319-92003389 [+]
hsa-mir-19b-1 chr13: 92003446-92003532 [+]
hsa-mir-92a-1 chr13: 92003568-92003645 [+]
Database links

Mature sequence hsa-miR-17-5p

Accession MIMAT0000070
Previous IDs hsa-miR-17-5p;hsa-miR-17
Sequence

14 - 

caaagugcuuacagugcagguag

 - 36

Get sequence
Deep sequencing 31906 reads, 42 experiments
Evidence experimental; cloned [2,5-8], Northern [4]
Validated targets
Predicted targets

Mature sequence hsa-miR-17-3p

Accession MIMAT0000071
Previous IDs hsa-miR-17-3p;hsa-miR-17*
Sequence

51 - 

acugcagugaaggcacuuguag

 - 72

Get sequence
Deep sequencing 3947 reads, 33 experiments
Evidence experimental; cloned [1,5,7-8], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).