Stem-loop sequence hsa-mir-16-1

Accession MI0000070
Previous IDs hsa-mir-16-13;hsa-mir-16
Symbol HGNC:MIR16-1
Description Homo sapiens miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ag   c          -  a        c u   gauu 
gucagc  ugc uuagcagcac gu aauauugg g uaa    c
||||||  ||| |||||||||| || |||||||| | |||     
caguug  aug agucgucgug ca uuaugacc c auu    u
      ga   a          u  a        u u   aaaa 
Get sequence
Deep sequencing
26576 reads, 43 experiments
Comments

Human miR-16 has been cloned by independent groups [1,2]. This precursor sequence maps to chromosome 13, and was named mir-16 in [1] and mir-16-precursor-13 in [2]. Lim et al. reported 2 identical chromosome 13 loci, which appear to map to the same locus in subsequent genome assemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [3]. A second putative mir-16 hairpin precursor is located on chromosome 3 (MI0000738 ).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 50623109-50623197 [-]
sense
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
ENST00000433070 ; DLEU2-001; intron 3
ENST00000433070 ; DLEU2-001; intron 3
ENST00000433070 ; DLEU2-001; intron 3
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
Clustered miRNAs
< 10kb from hsa-mir-16-1
hsa-mir-15a chr13: 50623255-50623337 [-]
hsa-mir-16-1 chr13: 50623109-50623197 [-]
Database links

Mature sequence hsa-miR-16-5p

Accession MIMAT0000069
Previous IDs hsa-miR-16
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Deep sequencing 53068 reads, 43 experiments
Evidence experimental; cloned [1,5,7-9], Northern [1,6]
Validated targets
Predicted targets

Mature sequence hsa-miR-16-1-3p

Accession MIMAT0004489
Previous IDs hsa-miR-16-1*
Sequence

56 - 

ccaguauuaacugugcugcuga

 - 77

Get sequence
Deep sequencing 15 reads, 6 experiments
Evidence experimental; cloned [8]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
4
PMID:12434020 "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia" Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM Proc Natl Acad Sci U S A. 99:15524-15529(2002).
5
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
6
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
7
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
8
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).