|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0000068 |
||||||
| Accession | MI0000068 | |||||
| ID | hsa-let-7f-2 | |||||
| Symbol | HGNC:MIRLET7F2 | |||||
| Description | Homo sapiens let-7f-2 stem-loop | |||||
| Stem-loop |
u u gu uuagggucauac guggga gag aguagauuguauaguu c |||||| ||| |||||||||||||||| cacccu uuc ucaucugacauaucaa c g - ug uagagguucuac |
|||||
| Genome context |
View flanking features |
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
| Gene family |
MIPF0000002; let-7 |
|||||
Mature sequence MIMAT0000067 |
|
| Accession | MIMAT0000067 |
| ID | hsa-let-7f |
| Sequence |
8 - ugagguaguagauuguauaguu - 29 |
| Evidence | experimental; cloned [1,3-5], Northern [1] |
| Predicted targets |
|
Minor miR* sequence MIMAT0004487 |
|
| Accession | MIMAT0004487 |
| ID | hsa-let-7f-2* |
| Sequence |
58 - cuauacagucuacugucuuucc - 79 |
| Evidence | experimental; cloned [4] |
| Predicted targets |
|
References |
|
| 1 |
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
| 2 |
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
| 3 |
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
| 4 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|