Stem-loop sequence hsa-let-7f-2

Accession MI0000068
Previous IDs hsa-let-7f-2L
Symbol HGNC:MIRLET7F2
Description Homo sapiens let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u      u   gu                uuagggucauac 
 guggga gag  aguagauuguauaguu            c
 |||||| |||  ||||||||||||||||             
 cacccu uuc  ucaucugacauaucaa            c
g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
reads, experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 53584153-53584235 [-]
sense
OTTHUMT00000056767 ; HUWE1-002; intron 34
OTTHUMT00000056767 ; HUWE1-002; intron 34
OTTHUMT00000056767 ; HUWE1-002; intron 34
OTTHUMT00000056766 ; HUWE1-001; intron 59
OTTHUMT00000056766 ; HUWE1-001; intron 59
OTTHUMT00000056766 ; HUWE1-001; intron 59
ENST00000427052 ; HUWE1-002; intron 34
ENST00000427052 ; HUWE1-002; intron 34
ENST00000427052 ; HUWE1-002; intron 34
ENST00000342160 ; HUWE1-001; intron 59
ENST00000342160 ; HUWE1-001; intron 59
ENST00000342160 ; HUWE1-001; intron 59
ENST00000262854 ; HUWE1-201; intron 60
ENST00000262854 ; HUWE1-201; intron 60
ENST00000262854 ; HUWE1-201; intron 60
Clustered miRNAs
< 10kb from hsa-let-7f-2
hsa-let-7f-2 chrX: 53584153-53584235 [-]
hsa-mir-98 chrX: 53583184-53583302 [-]
Database links

Mature sequence hsa-let-7f-5p

Accession MIMAT0000067
Previous IDs hsa-let-7f
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence experimental; cloned [1,3-5], Northern [1], Solexa [6]
Validated targets
Predicted targets

Mature sequence hsa-let-7f-2-3p

Accession MIMAT0004487
Previous IDs hsa-let-7f-2*
Sequence

58 - 

cuauacagucuacugucuuucc

 - 79

Get sequence
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6