Stem-loop sequence hsa-let-7f-1

AccessionMI0000067 (change log)
Previous IDshsa-let-7f-1L
Symbol HGNC:MIRLET7F1
DescriptionHomo sapiens let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1093 open access papers mention hsa-let-7f-1
(5988 sentences)

Stem-loop
       a ug                      ---------       u 
5' ucag g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 
Get sequence
Deep sequencing
55985340 reads, 1.09e+05 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 94176347-94176433 [+]
antisense
OTTHUMT00000053038 ; NFIL3-001; intron 1
ENST00000297689 ; NFIL3-001; intron 1
Clustered miRNAs
< 10kb from hsa-let-7f-1
hsa-let-7a-1chr9: 94175957-94176036 [+]
hsa-let-7f-1chr9: 94176347-94176433 [+]
hsa-let-7dchr9: 94178834-94178920 [+]
Database links

Mature sequence hsa-let-7f-5p

Accession MIMAT0000067
Previous IDshsa-let-7f
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Deep sequencing115380455 reads, 159 experiments
Evidence experimental; cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

Mature sequence hsa-let-7f-1-3p

Accession MIMAT0004486
Previous IDshsa-let-7f-1*
Sequence

63 - 

cuauacaaucuauugccuuccc

 - 84

Get sequence
Deep sequencing5510 reads, 136 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6