Stem-loop sequence hsa-let-7e

AccessionMI0000066 (change log)
Previous IDshsa-let-7eL
Symbol HGNC:MIRLET7E
DescriptionHomo sapiens let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

1095 open access papers mention hsa-let-7e
(5997 sentences)

Stem-loop
     c   cu   g                u  ----gga  a 
5' cc ggg  gag uaggagguuguauagu ga       gg c
   || |||  ||| |||||||||||||||| ||       ||  
3' gg ccc  uuc auccuccggcauauca cu       cc a
     a   cu   g                -  agaggaa  c 
Get sequence
Deep sequencing
25331368 reads, 5.09e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 51692786-51692864 [+]
sense
OTTHUMT00000465190 ; SIGLEC20P-001; intron 6
ENST00000595243 ; SIGLEC20P-001; intron 6
Clustered miRNAs
< 10kb from hsa-let-7e
hsa-mir-99bchr19: 51692612-51692681 [+]
hsa-let-7echr19: 51692786-51692864 [+]
hsa-mir-125achr19: 51693254-51693339 [+]
Database links

Mature sequence hsa-let-7e-5p

Accession MIMAT0000066
Previous IDshsa-let-7e
Sequence

8 - 

ugagguaggagguuguauaguu

 - 29

Get sequence
Deep sequencing25324137 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [1], Illumina [5]
Database links
Predicted targets

Mature sequence hsa-let-7e-3p

Accession MIMAT0004485
Previous IDshsa-let-7e*
Sequence

53 - 

cuauacggccuccuagcuuucc

 - 74

Get sequence
Deep sequencing7171 reads, 150 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5