Stem-loop sequence hsa-let-7d

AccessionMI0000065 (change log)
Previous IDshsa-let-7dL
Symbol HGNC:MIRLET7D
DescriptionHomo sapiens let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

1090 open access papers mention hsa-let-7d
(5870 sentences)

Stem-loop
          a              c      uuagggcagggauu 
5' ccuagga gagguaguagguug auaguu              u
   ||||||| |||||||||||||| ||||||               
3' ggauucu uuccgucguccagc uaucaa              u
          -              a      uggaggaacacccg 
Get sequence
Deep sequencing
1676851 reads, 4.65e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 94178834-94178920 [+]
antisense
OTTHUMT00000053038 ; NFIL3-001; intron 1
ENST00000297689 ; NFIL3-001; intron 1
Clustered miRNAs
< 10kb from hsa-let-7d
hsa-let-7a-1chr9: 94175957-94176036 [+]
hsa-let-7f-1chr9: 94176347-94176433 [+]
hsa-let-7dchr9: 94178834-94178920 [+]
Database links

Mature sequence hsa-let-7d-5p

Accession MIMAT0000065
Previous IDshsa-let-7d
Sequence

8 - 

agagguaguagguugcauaguu

 - 29

Get sequence
Deep sequencing1643048 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [1], Illumina [5]
Database links
Predicted targets

Mature sequence hsa-let-7d-3p

Accession MIMAT0004484
Previous IDshsa-let-7d*
Sequence

62 - 

cuauacgaccugcugccuuucu

 - 83

Get sequence
Deep sequencing33780 reads, 157 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5