Stem-loop sequence hsa-let-7c

AccessionMI0000064 (change log)
Previous IDshsa-let-7cL
Symbol HGNC:MIRLET7C
DescriptionHomo sapiens let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

1116 open access papers mention hsa-let-7c
(6526 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
68358324 reads, 1.36e+05 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 16539828-16539911 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-let-7c
hsa-mir-99achr21: 16539089-16539169 [+]
hsa-let-7cchr21: 16539828-16539911 [+]
Database links

Mature sequence hsa-let-7c-5p

Accession MIMAT0000064
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Deep sequencing68354180 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [1], Illumina [5-6]
Database links
Predicted targets

Mature sequence hsa-let-7c-3p

Accession MIMAT0026472
Sequence

56 - 

cuguacaaccuucuagcuuucc

 - 77

Get sequence
Deep sequencing2663 reads, 124 experiments
Evidence experimental; Illumina [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).