Stem-loop sequence hsa-let-7b

AccessionMI0000063 (change log)
Previous IDshsa-let-7bL
Symbol HGNC:MIRLET7B
DescriptionHomo sapiens let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

1157 open access papers mention hsa-let-7b
(6780 sentences)

Stem-loop
        u                     ucagggcagugaug 
5' cgggg gagguaguagguugugugguu              u
   ||||| |||||||||||||||||||||               
3' guccc uuccgucauccaacauaucaa              u
        -                     uagaaggcuccccg 
Get sequence
Deep sequencing
41519300 reads, 8.34e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 46113686-46113768 [+]
sense
OTTHUMT00000322280 ; ATXN10-004; intron 1
OTTHUMT00000318142 ; ATXN10-001; intron 5
OTTHUMT00000322278 ; ATXN10-002; intron 5
ENST00000476998 ; ATXN10-004; intron 1
ENST00000381061 ; ATXN10-201; intron 4
ENST00000252934 ; ATXN10-001; intron 5
ENST00000498009 ; ATXN10-002; intron 5
Clustered miRNAs
< 10kb from hsa-let-7b
hsa-let-7a-3chr22: 46112749-46112822 [+]
hsa-mir-4763chr22: 46113566-46113657 [+]
hsa-let-7bchr22: 46113686-46113768 [+]
Database links

Mature sequence hsa-let-7b-5p

Accession MIMAT0000063
Previous IDshsa-let-7b
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Deep sequencing41499458 reads, 159 experiments
Evidence experimental; cloned [1,3-5], Northern [1]
Database links
Predicted targets

Mature sequence hsa-let-7b-3p

Accession MIMAT0004482
Previous IDshsa-let-7b*
Sequence

60 - 

cuauacaaccuacugccuuccc

 - 81

Get sequence
Deep sequencing19672 reads, 153 experiments
Evidence experimental; cloned [4-5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).