Stem-loop sequence hsa-let-7a-3

Accession MI0000062
Previous IDs hsa-let-7a-3L
Symbol HGNC:MIRLET7A3
Description Homo sapiens let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   gu                ---------        
ggg gag  aguagguuguauaguu         uggggcu 
||| |||  ||||||||||||||||         |||||| c
ucc uuc  ucaucuaacauaucaa         gucccgu 
   u   ug                uaggguauc        
Get sequence
Deep sequencing
8489989 reads, 47 experiments
Comments

let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 46508629-46508702 [+]
sense
OTTHUMT00000316781 ; RP4-695O20__B.10-001; exon 5
OTTHUMT00000316781 ; RP4-695O20__B.10-001; exon 5
OTTHUMT00000316781 ; RP4-695O20__B.10-001; exon 5
ENST00000360737 ; MIRLET7BHG-001; exon 5
ENST00000360737 ; RP4-695O20__B.10-001; exon 5
ENST00000360737 ; hsa-mir-4763.1-001; exon 5
Clustered miRNAs
< 10kb from hsa-let-7a-3
hsa-let-7a-3 chr22: 46508629-46508702 [+]
hsa-mir-4763 chr22: 46509446-46509537 [+]
hsa-let-7b chr22: 46509566-46509648 [+]
Database links

Mature sequence hsa-let-7a-5p

Accession MIMAT0000062
Previous IDs hsa-let-7a
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Deep sequencing 25466940 reads, 49 experiments
Evidence experimental; cloned [1-3,5-8], Northern [1], Solexa [9]
Validated targets
Predicted targets

Mature sequence hsa-let-7a-3p

Accession MIMAT0004481
Previous IDs hsa-let-7a*
Sequence

52 - 

cuauacaaucuacugucuuuc

 - 72

Get sequence
Deep sequencing 2013 reads, 29 experiments
Evidence experimental; cloned [6]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).
9