Stem-loop sequence hsa-let-7a-3

AccessionMI0000062 (change log)
Previous IDshsa-let-7a-3L
Symbol HGNC:MIRLET7A3
DescriptionHomo sapiens let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Literature search

1266 open access papers mention hsa-let-7a-3
(7678 sentences)

Stem-loop
      u   gu                ---------        
5' ggg gag  aguagguuguauaguu         uggggcu 
   ||| |||  ||||||||||||||||         |||||| c
3' ucc uuc  ucaucuaacauaucaa         gucccgu 
      u   ug                uaggguauc        
Get sequence
Deep sequencing
71732473 reads, 1.43e+05 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 46112749-46112822 [+]
sense
OTTHUMT00000322280 ; ATXN10-004; intron 1
OTTHUMT00000318142 ; ATXN10-001; intron 5
OTTHUMT00000322278 ; ATXN10-002; intron 5
ENST00000476998 ; ATXN10-004; intron 1
ENST00000381061 ; ATXN10-201; intron 4
ENST00000252934 ; ATXN10-001; intron 5
ENST00000498009 ; ATXN10-002; intron 5
Clustered miRNAs
< 10kb from hsa-let-7a-3
hsa-let-7a-3chr22: 46112749-46112822 [+]
hsa-mir-4763chr22: 46113566-46113657 [+]
hsa-let-7bchr22: 46113686-46113768 [+]
Database links

Mature sequence hsa-let-7a-5p

Accession MIMAT0000062
Previous IDshsa-let-7a
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Deep sequencing215985765 reads, 159 experiments
Evidence experimental; cloned [1-3,5-8], Northern [1], Illumina [9]
Database links
Predicted targets

Mature sequence hsa-let-7a-3p

Accession MIMAT0004481
Previous IDshsa-let-7a*
Sequence

52 - 

cuauacaaucuacugucuuuc

 - 72

Get sequence
Deep sequencing50852 reads, 158 experiments
Evidence experimental; cloned [6]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).
9