Stem-loop sequence MI0000060

Accession

MI0000060

ID

hsa-let-7a-1

Symbol

HGNC:MIRLET7A1

Description

Homo sapiens let-7a-1 stem-loop

Stem-loop

     u   gu                uuagggucacac 
uggga gag  aguagguuguauaguu            c
||||| |||  ||||||||||||||||            c
auccu uuc  ucaucuaacauaucaa            a
     -   ug                uagagggucacc 

Comments

let-7a* cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context

• Coordinates (GRCh37): 9: 96938239-96938318 [+]
• Overlapping transcripts:

  intergenic

View flanking features

Clustered miRNAs

< 10kb from hsa-let-7a-1

• hsa-let-7a-1: 9: 96938239-96938318 [+]
• hsa-let-7f-1: 9: 96938629-96938715 [+]
• hsa-let-7d: 9: 96941116-96941202 [+]

Database links

• EMBL:AJ421724
• RFAM: RF00027;let-7
• HGNC: 31476;MIRLET7A1
• ENTREZGENE: 406881;MIRLET7A1

Gene family

MIPF0000002; let-7

Mature sequence MIMAT0000062

• Accession: MIMAT0000062
• ID: hsa-let-7a
• Sequence: 6 - ugagguaguagguuguauaguu - 27
• Evidence: experimental; cloned [1-3,5-8], Northern [1]
• Predicted targets:
  • MICROCOSM:hsa-let-7a
  • TARGETSCAN:hsa-let-7a
  • PICTAR-VERT:hsa-let-7a

Minor miR* sequence MIMAT0004481

• Accession: MIMAT0004481
• ID: hsa-let-7a*
• Sequence: 57 - cuauacaaucuacugucuuuc - 77
• Evidence: experimental; cloned [6]
• Predicted targets:
  • MICROCOSM:hsa-let-7a*
  • TARGETSCAN:hsa-let-7a*

References

1. "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6. "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8. "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).