|
miRBase |
|
Stem-loop sequence MI0000060 |
||||||||
| Accession | MI0000060 | |||||||
| ID | hsa-let-7a-1 | |||||||
| Symbol | HGNC:MIRLET7A1 | |||||||
| Description | Homo sapiens let-7a-1 stem-loop | |||||||
| Stem-loop |
u gu uuagggucacac uggga gag aguagguuguauaguu c ||||| ||| |||||||||||||||| c auccu uuc ucaucuaacauaucaa a - ug uagagggucacc |
|||||||
| Comments |
let-7a* cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. |
|||||||
| Genome context |
View flanking features |
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
| Gene family |
MIPF0000002; let-7 |
|||||||
Mature sequence MIMAT0000062 |
|
| Accession | MIMAT0000062 |
| ID | hsa-let-7a |
| Sequence |
6 - ugagguaguagguuguauaguu - 27 |
| Evidence | experimental; cloned [1-3,5-8], Northern [1], Solexa [9] |
| Predicted targets |
|
Minor miR* sequence MIMAT0004481 |
|
| Accession | MIMAT0004481 |
| ID | hsa-let-7a* |
| Sequence |
57 - cuauacaaucuacugucuuuc - 77 |
| Evidence | experimental; cloned [6] |
| Predicted targets |
|
References |
|
| 1 |
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
| 2 |
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
| 3 |
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
| 4 |
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
| 5 |
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
| 6 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 7 |
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
| 8 | |
| 9 | |