Stem-loop sequence cel-mir-90

AccessionMI0000059 (change log)
DescriptionCaenorhabditis elegans miR-90 stem-loop
Gene family MIPF0000221; mir-90
Stem-loop
   g    -   u      c   u     -    g        -  a   cuc 
5'  ggcg cca uucgag ggc uucaa cgac auaucaac cg caa   a
    |||| ||| |||||| ||| ||||| |||| |||||||| || |||   c
3'  ccgu ggu aaguuc ccg aaguu guug uauaguug gc guu   a
   a    a   u      c   u     u    -        u  -   uuc 
Get sequence
Deep sequencing
84532 reads, 441 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

mir-90 is has found to be most abundant in the L1 stage of larval development in Caenorhabditis elegans [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [4].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 8873987-8874084 [-]
sense
K01F9.2 ; K01F9.2; intron 4
antisense
K01F9.7 ; K01F9.7; exon 1
Clustered miRNAs
< 10kb from cel-mir-90
cel-mir-90chrIII: 8873987-8874084 [-]
cel-mir-238chrIII: 8867328-8867425 [-]
cel-mir-80chrIII: 8865270-8865367 [-]
Database links

Mature sequence cel-miR-90-5p

Accession MIMAT0020326
Previous IDscel-miR-90*
Sequence

16 - 

cggcuuucaacgacgauaucaac

 - 38

Get sequence
Deep sequencing1692 reads, 17 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-90-3p

Accession MIMAT0000061
Previous IDscel-miR-90
Sequence

62 - 

ugauauguuguuugaaugccccu

 - 84

Get sequence
Deep sequencing82798 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7