Stem-loop sequence cel-mir-87

AccessionMI0000058 (change log)
DescriptionCaenorhabditis elegans miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

6 open access papers mention cel-mir-87
(13 sentences)

Stem-loop
   -   u   cca      -       u     c u    a   -  -   uc 
5'  ggu gug   uccggc cgccuga acuuu g cuca ccu cg cug  a
    ||| |||   |||||| ||||||| ||||| | |||| ||| || |||   
3'  cca cac   aggccg guggacu ugaaa c gagu gga gc ggu  g
   c   -   --a      u       u     - -    -   u  u   ua 
Get sequence
Deep sequencing
57811 reads, 765 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

mir-87 is has found to be most abundant in the L1 stage of larval development in Caenorhabditis elegans. mir-87 orthologues have been found in C. briggsae, Drosophila melanogaster and humans [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [4].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 12038688-12038781 [-]
sense
F10C2.2 ; F10C2.2; intron 1
antisense
F10C2.11 ; F10C2.11; exon 1
Database links

Mature sequence cel-miR-87-5p

Accession MIMAT0020325
Previous IDscel-miR-87*
Sequence

17 - 

cgccugauacuuucgucucaaccu

 - 40

Get sequence
Deep sequencing107 reads, 12 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-87-3p

Accession MIMAT0000060
Previous IDscel-miR-87
Sequence

61 - 

gugagcaaaguuucaggugugc

 - 82

Get sequence
Deep sequencing56749 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7