Stem-loop sequence cel-mir-85

AccessionMI0000056 (change log)
DescriptionCaenorhabditis elegans miR-85 stem-loop
Gene family MIPF0000249; mir-85
Literature search

2 open access papers mention cel-mir-85
(5 sentences)

Stem-loop
   uau       uggcg       c           -  g    a     ---   u 
5'    agaauuu     ucggagc cgauuuuucaa ua uuug aacca   gug a
      |||||||     ||||||| ||||||||||| || |||| |||||   |||  
3'    ucuuaag     agucucg gcugaaaaguu au aaac uuggu   uac c
   -au       -uaaa       u           u  g    a     aaa   a 
Get sequence
Deep sequencing
150955 reads, 1.79e+03 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 8393553-8393658 [+]
antisense
F49E12.8 ; F49E12.8; intron 2
Database links

Mature sequence cel-miR-85-5p

Accession MIMAT0020324
Previous IDscel-miR-85*
Sequence

23 - 

ccgauuuuucaauaguuugaaac

 - 45

Get sequence
Deep sequencing141 reads, 6 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-85-3p

Accession MIMAT0000058
Previous IDscel-miR-85
Sequence

65 - 

uacaaaguauuugaaaagucgugc

 - 88

Get sequence
Deep sequencing150765 reads, 14 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7