Stem-loop sequence cel-mir-84

AccessionMI0000055 (change log)
DescriptionCaenorhabditis elegans miR-84 stem-loop
Gene family MIPF0000250; mir-84
Literature search

28 open access papers mention cel-mir-84
(128 sentences)

Stem-loop
   gu    u     g    a  u        a   uguc 
5'   ggca cugag uagu ug aauauugu gac    u
     |||| ||||| |||| || |||||||| |||     
3'   uugu ggcuc auca ac uuguaaca cug    a
   uc    c     a    -  u        c   uaau 
Get sequence
Deep sequencing
814018 reads, 2.74e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 16022404-16022478 [-]
intergenic
Database links

Mature sequence cel-miR-84-5p

Accession MIMAT0000057
Previous IDscel-miR-84
Sequence

9 - 

ugagguaguauguaauauuguaga

 - 32

Get sequence
Deep sequencing811643 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-84-3p

Accession MIMAT0015110
Previous IDscel-miR-84*
Sequence

47 - 

cacaauguuucaacuaacucggc

 - 69

Get sequence
Deep sequencing2370 reads, 14 experiments
Evidence experimental; CLIPseq [6], Illumina [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7