Stem-loop sequence cel-mir-83

AccessionMI0000054 (change log)
DescriptionCaenorhabditis elegans miR-83 stem-loop
Gene family MIPF0000251; mir-83
Literature search

3 open access papers mention cel-mir-83
(3 sentences)

Stem-loop
      a - -  u     cc              u  a  u  -  --  caa 
5' agc c c ac cggaa  acugaauuuaugug gu cu ga cg  gc   c
   ||| | | || |||||  |||||||||||||| || || || ||  ||    
3' ucg g g ug gcuuu  ugacuuaaauauac ca ga cu gc  cg   a
      a a c  c     aa              -  c  u  a  ua  aga 
Get sequence
Deep sequencing
75621 reads, 859 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 7841631-7841728 [+]
sense
C06A6.9 ; C06A6.9; exon 1
Database links

Mature sequence cel-miR-83-5p

Accession MIMAT0020775
Sequence

17 - 

acugaauuuauguguguacuuga

 - 39

Get sequence
Deep sequencing4117 reads, 15 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-83-3p

Accession MIMAT0000056
Previous IDscel-miR-83
Sequence

61 - 

uagcaccauauaaauucaguaa

 - 82

Get sequence
Deep sequencing71458 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7