Stem-loop sequence cel-mir-82

AccessionMI0000053 (change log)
DescriptionCaenorhabditis elegans miR-82 stem-loop
Gene family MIPF0000154; mir-81
Literature search

8 open access papers mention cel-mir-82
(32 sentences)

Stem-loop
   gaaaua     -uuuu      c       u u       a    a   ca 
5'       gguuc     agcaac gguuuuc c gugaucu caga uga  g
         |||||     |||||| ||||||| | ||||||| |||| |||  c
3'       ucaag     uuguug ccgaaag g uacuaga gucu gcu  u
   -----c     uauuu      a       u c       -    -   aa 
Get sequence
Deep sequencing
4111790 reads, 2.05e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2435258-2435354 [-]
sense
T07D1.2.2 ; T07D1.2.2; intron 1
T07D1.2.1 ; T07D1.2.1; intron 2
Clustered miRNAs
< 10kb from cel-mir-82
cel-mir-82chrX: 2435258-2435354 [-]
cel-mir-81chrX: 2431072-2431179 [+]
Database links

Mature sequence cel-miR-82-5p

Accession MIMAT0020323
Previous IDscel-miR-82*
Sequence

22 - 

cgguuuucucugugaucuacaga

 - 44

Get sequence
Deep sequencing1709 reads, 14 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-82-3p

Accession MIMAT0000055
Previous IDscel-miR-82
Sequence

61 - 

ugagaucaucgugaaagccagu

 - 82

Get sequence
Deep sequencing4110051 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6