Stem-loop sequence cel-mir-81

AccessionMI0000052 (change log)
DescriptionCaenorhabditis elegans miR-81 stem-loop
Gene family MIPF0000154; mir-81
Literature search

10 open access papers mention cel-mir-81
(55 sentences)

Stem-loop
   aucagu   au    -c       uc         c       g   ---   auc 
5'       gcc  cgug  ccaacag  gguuuucac gugaucu aga   gca   c
         |||  ||||  |||||||  ||||||||| ||||||| |||   |||   a
3'       cgg  gcau  gguuguu  ucgaaagug uacuaga ucu   cgu   a
   -guuuu   --    cu       ga         c       g   uuu   aaa 
Get sequence
Deep sequencing
4111064 reads, 2.05e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2431072-2431179 [+]
antisense
T07D1.2.2 ; T07D1.2.2; intron 5
T07D1.2.1 ; T07D1.2.1; intron 6
Clustered miRNAs
< 10kb from cel-mir-81
cel-mir-81chrX: 2431072-2431179 [+]
cel-mir-82chrX: 2435258-2435354 [-]
Database links

Mature sequence cel-miR-81-5p

Accession MIMAT0015109
Previous IDscel-miR-81*
Sequence

25 - 

cgguuuucaccgugaucugaga

 - 46

Get sequence
Deep sequencing1218 reads, 14 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-81-3p

Accession MIMAT0000054
Previous IDscel-miR-81
Sequence

67 - 

ugagaucaucgugaaagcuagu

 - 88

Get sequence
Deep sequencing4109835 reads, 17 experiments
Evidence experimental; cloned [1-4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).