|
miRBase |
|
Stem-loop sequence cel-mir-80 |
||||||||
| Accession | MI0000051 | |||||||
| Description | Caenorhabditis elegans miR-80/miR-227 stem-loop | |||||||
| Gene family | MIPF0000258; mir-80 | |||||||
| Stem-loop |
auggaca -gu c a -- u g ----c g cuc ucg uc gcuuucgac augau cu aacaau c c ||| ||| || ||||||||| ||||| || |||||| | gag agu ag cgaaaguug uacua ga uuguug g a --cuaua acu a c au - g uaccc a |
|||||||
| Deep sequencing |
| |||||||
| Comments |
mir-80 is conserved in C.briggsae (MI0000518 ) [1]. Reference [3] reports the identification of miR-227, which appears to be expressed from the 5' arm of the same precursor. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence cel-miR-80-5p |
|
| Accession | MIMAT0000052 |
| Previous IDs | cel-miR-227 |
| Sequence |
19 - agcuuucgacaugauucugaac - 40 |
| Deep sequencing | 150 reads, 5 experiments |
| Evidence | experimental; cloned [3], Solexa [6], CLIPseq [7] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence cel-miR-80-3p |
|
| Accession | MIMAT0000053 |
| Previous IDs | cel-miR-80 |
| Sequence |
61 - ugagaucauuaguugaaagccga - 83 |
| Deep sequencing | 75426 reads, 6 experiments |
| Evidence | experimental; cloned [1-5], Northern [1], Solexa [6], CLIPseq [7] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
| 2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|
| 3 |
PMID:12747828
"MicroRNAs and other tiny endogenous RNAs in C. elegans"
Curr Biol. 13:807-818(2003).
|
| 4 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
| 5 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
| 6 | |
| 7 |
PMID:20062054
"Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
Nat Struct Mol Biol. 17:173-179(2010).
|