Stem-loop sequence cel-mir-80

AccessionMI0000051 (change log)
DescriptionCaenorhabditis elegans miR-80/miR-227 stem-loop
Gene family MIPF0000258; mir-80
Literature search

9 open access papers mention cel-mir-80
(304 sentences)

Stem-loop
   auggaca   -gu   c  a         --     u  g      ----c g 
5'        cuc   ucg uc gcuuucgac  augau cu aacaau     c c
          |||   ||| || |||||||||  ||||| || ||||||     |  
3'        gag   agu ag cgaaaguug  uacua ga uuguug     g a
   --cuaua   acu   a  c         au     -  g      uaccc a 
Get sequence
Deep sequencing
818094 reads, 1.17e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

mir-80 is conserved in C.briggsae (MI0000518) [1]. Reference [3] reports the identification of miR-227, which appears to be expressed from the 5' arm of the same precursor.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 8865270-8865367 [-]
antisense
K01F9.6 ; K01F9.6; exon 1
Clustered miRNAs
< 10kb from cel-mir-80
cel-mir-90chrIII: 8873987-8874084 [-]
cel-mir-238chrIII: 8867328-8867425 [-]
cel-mir-80chrIII: 8865270-8865367 [-]
Database links

Mature sequence cel-miR-80-5p

Accession MIMAT0000052
Previous IDscel-miR-227
Sequence

19 - 

agcuuucgacaugauucugaac

 - 40

Get sequence
Deep sequencing26440 reads, 17 experiments
Evidence experimental; cloned [3], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-miR-80-3p

Accession MIMAT0000053
Previous IDscel-miR-80
Sequence

61 - 

ugagaucauuaguugaaagccga

 - 83

Get sequence
Deep sequencing791447 reads, 17 experiments
Evidence experimental; cloned [1-4], Northern [1], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).