Stem-loop sequence cel-mir-78

AccessionMI0000049 (change log)
DescriptionCaenorhabditis elegans miR-78 stem-loop
Stem-loop
   aauaaaauauauug    au  ug -  -   -          -a   auuuu  a 
5'               uuuc  ag  u cc gua aaauaacuag  uuu     gu a
                 ||||  ||  | || ||| ||||||||||  |||     ||  
3'               agag  uu  a gg cgu uuuguugguc  gag     ca a
   --------------    cu  gu a  u   g          cg   guuau  a 
Get sequence
Deep sequencing
11210 reads, 29.4 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 15165647-15165742 [+]
intergenic
Database links

Mature sequence cel-miR-78

Accession MIMAT0000050
Sequence

61 - 

uggaggccugguuguuugugc

 - 81

Get sequence
Deep sequencing11204 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4