Stem-loop sequence cel-mir-77

AccessionMI0000048 (change log)
DescriptionCaenorhabditis elegans miR-77 stem-loop
Gene family MIPF0000272; mir-77
Literature search

2 open access papers mention cel-mir-77
(2 sentences)

Stem-loop
   gcaucugc     - ---   c               cu    g     ac   c 
5'         caaac c   gcc guuuggaugguugug  cuga gaaau  gca a
           ||||| |   ||| |||||||||||||||  |||| |||||  ||| g
3'         guuug g   ugg uaaaccugucgauac  gacu cuuua  ugu a
   --------     a aua   u               cg    a     -c   a 
Get sequence
Deep sequencing
160536 reads, 3.1e+03 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 12519268-12519367 [+]
intergenic
Database links

Mature sequence cel-miR-77-5p

Accession MIMAT0020774
Sequence

24 - 

gaugguugugcucugaggaaau

 - 45

Get sequence
Deep sequencing21449 reads, 13 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-77-3p

Accession MIMAT0000049
Previous IDscel-miR-77
Sequence

62 - 

uucaucaggccauagcugucca

 - 83

Get sequence
Deep sequencing139075 reads, 13 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6