Stem-loop sequence cel-mir-76

AccessionMI0000047 (change log)
DescriptionCaenorhabditis elegans miR-76 stem-loop
Gene family MIPF0000902; mir-76
Literature search

2 open access papers mention cel-mir-76
(3 sentences)

Stem-loop
   -a    -a         u        -      u      -  uu     u 
5'   uuuc  gcuccuguc gggcuuca caauag cgaaua cc  aaauu c
     ||||  ||||||||| |||||||| |||||| |||||| ||  |||||  
3'   aaag  uggggguag uccgaagu guuguu gcuuau gg  uuuaa a
   ag    ag         u        a      -      a  --     a 
Get sequence
Deep sequencing
3116 reads, 11.8 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 3142045-3142141 [+]
intergenic
Database links

Mature sequence cel-miR-76-5p

Accession MIMAT0020321
Previous IDscel-miR-76*
Sequence

16 - 

ugggcuucacaauagucgaaua

 - 37

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [6]

Mature sequence cel-miR-76-3p

Accession MIMAT0000048
Previous IDscel-miR-76
Sequence

61 - 

uucguuguugaugaagccuuga

 - 82

Get sequence
Deep sequencing3089 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6