Stem-loop sequence cel-mir-74

AccessionMI0000045 (change log)
DescriptionCaenorhabditis elegans miR-74 stem-loop
Gene family MIPF0000275; mir-74
Literature search

1 open access papers mention cel-mir-74
(1 sentences)

Stem-loop
   aaa     ca        uc     u    c    uc        cauc 
5'    ugguu  aaaaacgu  gggcu ccau ucuu  ccagccua    u
      |||||  ||||||||  ||||| |||| ||||  ||||||||     
3'    accaa  uuuuugca  ucuga ggua agaa  ggucgggu    c
   -aa     -c        ca     c    a    -c        ccaa 
Get sequence
Deep sequencing
15631 reads, 171 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2369043-2369139 [+]
sense
T24D8.14 ; T24D8.14; exon 1
antisense
T24D8.16 ; T24D8.16; exon 1
Clustered miRNAs
< 10kb from cel-mir-74
cel-mir-73chrX: 2368765-2368863 [+]
cel-mir-74chrX: 2369043-2369139 [+]
cel-mir-75chrX: 2372453-2372549 [+]
Database links

Mature sequence cel-miR-74-5p

Accession MIMAT0020320
Previous IDscel-miR-74*
Sequence

20 - 

cgggcuuccaucucuuucccagc

 - 42

Get sequence
Deep sequencing1068 reads, 15 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-74-3p

Accession MIMAT0000046
Previous IDscel-miR-74
Sequence

61 - 

uggcaagaaauggcagucuaca

 - 82

Get sequence
Deep sequencing14433 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7