Stem-loop sequence cel-mir-73

AccessionMI0000044 (change log)
DescriptionCaenorhabditis elegans miR-73 stem-loop
Gene family MIPF0000276; mir-73
Literature search

1 open access papers mention cel-mir-73
(1 sentences)

Stem-loop
   cagugagag   ---c  a            u  -     ga    ca  uauca 
5'          ucc    ac cacgacuggacu cc auauc  gcca  gc     a
            |||    || |||||||||||| || |||||  ||||  ||     c
3'          agg    ug guguugacuuga gg uguag  cggu  cg     g
   --------g   uauu  c            c  a     aa    --  uuuaa 
Get sequence
Deep sequencing
2509272 reads, 1.33e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2368765-2368863 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-73
cel-mir-73chrX: 2368765-2368863 [+]
cel-mir-74chrX: 2369043-2369139 [+]
cel-mir-75chrX: 2372453-2372549 [+]
Database links

Mature sequence cel-miR-73-5p

Accession MIMAT0020319
Previous IDscel-miR-73*
Sequence

23 - 

uggacuuccauaucgagccacagc

 - 46

Get sequence
Deep sequencing3083 reads, 17 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-73-3p

Accession MIMAT0000045
Previous IDscel-miR-73
Sequence

62 - 

uggcaagauguaggcaguucagu

 - 84

Get sequence
Deep sequencing2506184 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7